Advertisement.

EnchantedLearning.com is a user-supported site.
As a bonus, site members have access to a banner-ad-free version of the site, with print-friendly pages.
Click here to learn more.

(Already a member? Click here.)

Our subscribers' grade-level estimate for this page: 2nd

ZoomDinosaurs.com What is your Favorite Dinosaur? (Favorite Dinosaurs from late Oct. 2000) What is your favorite dinosaur and why?

Tyrannosaurus rex, because I think he's pretty neat.
from Lauren L., age 4, Eugene, Oregon, USA; October 31, 2000

Tyrannosaururs Rex
from Honkie Tong, age 16, ?, ?, ?; October 31, 2000

T,Rex!!!!!!!!!!!!!!!!!1
from Honky Tong, age 12, ?, ?, ?; October 31, 2000

overaptor:he is very fast
from Alan sutcliffe, age 9, new zealand, ?, aukland; October 31, 2000

14. Footprints

" Absolutely absurd." Verrand said, listening to the report over the radio. " That cannot be a raptor footprint!"

" I agree," Calleja said. " No animals have escaped from the Deinonychus paddock."

Sophin's voice clicked on, " Calleja?" He said. " Call you run a tally of the animals you have."

" Now?"

" Yes, right now. I understand you can transmit the data to the on-board laptops in the jeeps." Sophin's voice sounded stern.

" I'm on it."

A moment later, the screens in the control room printed out:

_________________________________________________ Total Tally
Species/Expected/Found

Tyrannosaurus /4/4/
Gigantosaurus /2/2/
Allosaurus /4/4/
Velociraptor /23/23/
Deinonychus /14/14/
Gallimimus /21/21/
Edmontosaurus /16/16/
Diplodocus /12/12/
Triceratops /15/15/
Carnotaurus /5/5/
Compsognathus /45/45/
Stegosaurus /4/4/
Brachiosaururs /2/2/
Ouranosaurus /10/10/
Oviraptor /9/9/
Ankylosaururs /3/3/
Ornitholestes /12/12/
Parasaurolophus /10/10/
Heterodontosaurus /18/18/
Utahraptor /6/6/
Ceratosaurus /5/5/
Leaellynasaura /18/18/
Total/258/258/

" See," Verrand, said, sounding satisfied, " We don't have any missing or extra animals anywhere."

" I'm not convinced." Sophin said over the intercom. " The computer must have run a glitch somewhere."

" I don't believe you," Verrand said. " What must we do to make you people see this island is safe."

The radio crackled, it was Truman. " All I know is, that's a set of raptor prints."

" I think so too." Sophin said. " Here, I'll prove it to you using your own data." The radio crackled. " Mr. Calleja, can you call up the Velociraptor height graph you show us earlier?"

" Sure thing." Calleja took a swig from a new Coke bottle and snubbed out his cigarette. He started punching a series of buttons with rapidity. The species tally blinked off and was replaced with another printout:

_______________________________________________________ Velociraptor height graph

Num. Of animals

7-------------------------------------------------------------*
6---------------------------------------------------*
5----------------------------------------------*
4-------------------------*
3----------*------------------------------------------------------------*
2---*
1*--------------------------------------------------------------------------*
---40---42---44---46---48---50---52---54---56---58---60---62---64
Height/cm

________________________________________________________ " What do you know about this?" Sophin asked.

" Well," Greg said, think hard. " It's a expected population height graph of our Velociraptors, since we introduced them in two batches, we naturally get two height maximums."

" Do your Velociraptors breed?" Sophin asked.

" Well, yes they do." Greg said. " We have had about one batch of hatchlings by now."

" In that case," Sophin said. " You should get a graph of a normal breeding population, something like this:" He tapped the keyboard of the jeep's laptop.

_______________________________________________________ Velociraptor height graph

Num. Of animals

7--------------------------*------------------*
6--------------------*--------------------------------*
5-----------------*---------------------------------------*
4--------------*----------------------------------------------*
3----------*--------------------------------------------------------*
2-----*------------------------------------------------------------------*
1-*---------------------------------------------------------------------------*
---40---42---44---46---48---50---52---54---56---58---60---62---64
Height/cm

________________________________________________________ " This is a Poisson distribution." Sophin explained. " The graph you should get for a healthy breeding population. Some hatchlings must have escaped from the paddocks, leaving a population graph of the Velociraptors in the paddock like your earlier graph."

" That's absurd. " Verrand said. " We counted every hatching that was hatched. Nothing slipped by us."

Truman's voice come in over the intercom. " How many Velociraptors hatchlings have you bred anyway."

Calleja hit a few keys and called up another screen. " We had a total of eleven hatchlings, from three nests."

" That's odd." Truman said. " From what I know, each nest should have from eight to twelve eggs. " He paused. " You data tells me that they laid an average of four eggs per nest, quite a small clutch isn't it?"

" But we didn't see any extra hatchlings turning up later, it doesn't make sense." Calleja said. " My data isn't wrong, all the Velociraptors hatched were eleven young."

" Well," Truman said. " Did anybody count the eggshells in the Velociraptor nest?" There was a long pause. " I didn't think so."

" All I know is," Calleja said. " My data isn't wrong. The Velociraptors must have eaten their young or something. I would know if a dinosaur had escaped, the computer would tell me. From what the computer says, no dinosaurs have escaped- everything is under control." He sounded annoyed.

" All I know is." Truman said. " These are raptor footprints."

" Impossible," Calleja said angrily. " I'll say this one more time; I know no dinosaur has escaped because the computer tells me that all of them are accounted for and in their paddocks. You can't argue with the computer. All you have to base your speculations on are footprints while we have cold, hard facts." Calleja felt offended that people would think a control system he spent years designing would fail at the simple task of keeping the animals in.

" Well," Sophin said. " I'm sure as time goes by, we will acquire more facts to support our speculations." The radio clicked off.

There was a long silence.

" Did any animals really escape?" Verrand asked Calleja worriedly.

" No!" He snapped. " The computer will tell us! Look, the last time the Deinonychus escaped, the computer warned us about it. We are not getting any alarms now, no missing animal warnings, zilch, nothing! I am telling you, all the animals are in their paddocks and safely behind the fences." He drank angrily from the Coke bottle and reached into his pocket for another cigarette.

" What about the footprints?" Verrand asked tensely.

" They are probably Ornitholestes footprints." Calleja said, " Probably heavily weathered Ornitholestes footprints. Really, you should have more faith in your island." He turned away from the old man and continued looking at his console.

In the jeeps, Gurmit turned to Truman and said. " Are you certain those are raptor footprints?"

Truman leaned back tensely, he looked at the muddy footprints. " Yes, this prints has only two toes, this was made by an animal than ran on two toes- like the raptor. The held their sickle claws up as they ran to avoid damaging them, thus the two toed imprint."

" I don't think so." Drummond said. " These are probably badly damaged Ornitholestes prints." He started the jeeps off and led the convoy away from the swamp. " The animals cannot escape- the computer would tell us if they did so."

A voice came over the intercom, it was Sophin. " Whatever it is, we will be clearer on this matter as time goes by."

They sat quietly in the jeeps.
from Billy Macdraw, age 18, ....., ......, ....; October 31, 2000

My favoute dinosaur is Allosaurs because it is a meateater. I like them also because they are big
from Aiden, age 7, Sydney, NSW, Austraila; October 31, 2000

Trex it was v a meateater
from Eddie H, age 11, Elanger, KY, U.S.A.; October 31, 2000

My favorite is the Flosser Raptor becease it`s the most flexable of all donosaurs
from Dan G., age 10, Duxbury, M.A., U.S; October 31, 2000

t rex because he is big.
from josh, age 7, Riverview, fl, ?; October 31, 2000

I think you have seriously underestimated dinos my friend. I study wound ballastics in my policing course. The reason the more bulk you have, the harder to kill you will be is mainly due to this reason. The wound tends to seal up behind the bullet if you are of sufficent bulk. Most hunters know a hit to the lungs is extremely difficult, expecially if the animal is running at 40 miles per hour straight at you from an ambush. I don't think one .50 cal is enough to kill a rex. A elephant, which is lighter and smaller takes alot of .50 to kill. In fact, big game hunters use a jury rigged weapon that throws out a 1 inch copper slug. A rex can certainly soak up far more damage. If what you say is true, that it wouldn't take more than a .50 cal to kill an elephant, then we should be killing bears with 9mm ammo.

Wound ballastics also says your rib fragmentation story is false. I know as a fact that if a bullet hits a rib, the rib fragments will be absorbed and stopped by the bulk of the animal. I think humans are quite different as they are very easy to kill as they lack in bulk. But I assure you, the difference is apparent if you go up against a bigger animal. Bulk takes in alot of damage. Infact, those expanding bullets and hollowpoints are even less effective. The bulk of the animal will actually stop any expanding or fragmenting rounds. I say we should use solid shot. It's like shooting a tank. You don't use antipersonel weapons, you use antitank weapons. What do you say?
from Davis L., age 19, ?, ?, ?; October 30, 2000

My favorite dinosaur is the Tricerotops because its three horns look really cool and it was one of the few who could stand up to the Tyrannosauros Rex. My 2nd and 3rd favorites are the T-Rex and Plesiosauros.
from Adit D., age 11, ?, NJ, USA; October 30, 2000

Tyrannosaururs
from Donno, age ......, why, I, voted him; October 30, 2000

13. Swamp

" Well," Calleja said finally. " We are out of fuel." He looked a flashing red light on his console, and started punching a few buttons. " Switching to reserve." The red light turned off.

" I don't like this." Verrand said. " We have never run on reserve before." He looked at the monitors apprehensively and sighed.

" You worry too much." Calleja said. " There is a first time for everything" He finished his warm Coke and put the bottle into the dustbin. " Using reserve fuel is a trivial problem compared to the problems we have with the control system." " Oh," Verrand said. " Don't start."

" But I am not kidding." Calleja said, looking at the ceiling. " This system consist of a network of seven supercomputers. They take care of everything from building Greg's DNA strand to feeding the food into the feeding containers. All this takes code," Calleja said. " A lot of code."

" The main operating system for this island has about four billion lines of code for the program itself- You wanted the island to be as automated as possible- you got it. Virtually everything is automated, and that requires a lot of programming- not to mention the genetics, they require a lot of memory and codes too." Calleja looked at the console before him.

" What's your point?" Verrand had heard that speech before. Calleja had always used that whenever a problem cropped up in the running of things. It was some kind of a complicated excuse.

" My point is," Calleja said. " With such a complex system, it's impossible to avoid problems. Minor problems like running on reserve fuel as nothing like the bugs we have yet to iron out of the system. You shouldn't worry about the fuel Bradley, worry about your visitors."

" But I still prefer to try running on reserve fuel when there are no guests around." Verrand said. " I want to make sure everything we do or try while they are around something we have done before, the stakes are too high now to let anything go wrong- do you understand me?"

" Perfectly," Calleja said. " We know this island is safe, let's see how it plays out."

Drummond stopped the jeeps again, near a small swamp. He had led the convoy from the main road and onto the plains to get a closer look at the animals. Two gigantic giraffe-like dinosaurs were feeding at the edge of a swamp, eating from what looked like a large metal tower with oversized cooking pots attached. In the same area were several Parasaurolophus, which looked much smaller in comparison. The gigantic dinosaurs were a dark gray with a creamy-yellow underbelly.

Truman knew they weren't really small of course, the gigantic dinosaurs; which Truman had identified as Brachiosaururs made them look small. The Parasaurolophus were also feeding from lower feeding containers, making a series of trombone like noises as they went. The calls ranged in diversity from a series of short bellows to a long continuous trumpet.

" Those metal towers are actually a refinement on the feeding containers." Drummond explained. " They are made specially for the Brachiosaururs. It allows them to feed as nature intended them to. Like the normal feeding containers, they replenish themselves automatically with food at feeding time."

" What do you feed the Brachiosaurs?" Gurmit asked, looking at the animals.

" They are not too picky, but they seem have a preference for pine cones and leaves." Drummond said. " But no matter what, we feed them in bulk. Being the biggest dinosaur, Brachiosaurs need a lot of food to keep going."

Gurmit didn't bother to contradict him. Actually, dinosaurs like Ultrasauros and Seismosaurus were even bigger. The biggest dinosaur was actually a mysterious find called Amphicoelias Fragillimus; estimated to be a 60 meters long, weighing a staggering 150 tons; almost as heavy as a blue wale. " How much do they weight?" Gurmit asked.

" We are not too sure yet." Drummond said. " The ones we have here are subadults that both weight about forty five to fifty five tons." He leaned out of the window to get a better view of the animals. " Our animals take about twelve to fifteen years to mature- so I'll tell you in five years." He smiled.

Alongside the Brachiosaurs, the smaller Parasaurolophus moved around, some on their hind legs, some on all fours. Several juvenile Parasaurolophus scampered around the adults, honking for attention. Some of the adults picked food out of the containers and dropped them for the youngsters, some of the juveniles ate straight from a smaller feeding container.

" The Parasaurolophus usually breed early in the year and leave their nesting grounds once their young are about two months old and ready to move." Drummond explained. " They take good care of their young; feeding them and moving around with a herd structure designed to protect the young."

Truman could see that Drummond was right; the Parasaurolophus herd arranged themselves in to put the youngsters in the center and the adults at the perimeter. Even as the members of the herd moved around, the formation still stayed relatively intact and well defined.

" I will take you closer for a better look." Drummond said, and started his jeep, leading the rest down towards the animals. A few of the animals looked at the jeeps with a cow-like stare before turning back to feed. Drummond parked the jeep convoy about seventy yards form the Parasaurolophus herd and waited.

A new animal came into view as it moved from behind a group of ferns. It was a curious animal built like an armored box covered from head to tail with a series of bony scutes, shields and plates. The animal's short, boxy body led to a thick tapering tail which ended in a massive bony club. The animal moved slowly with an air of nonchalance, swinging the tail slowly as it went. It reminded Truman of some kind of oversized terrestrial tortoise.

" Ankylosaurus." Drummond said. " One of the largest armored dinosaurs; look at the way it swings that tail, one blow will smash the tail of the predator. " The animal was moving towards them slowly. " These animals have very little brain in their reinforced skulls, but they do have a amazing turn of speed."

Truman knew that Ankylosaur trackways had been found in 1996 near Sucre, Bolivia, showing that these huge creatures could run at a "decent jog," according to Christian Meyer, a Swiss paleontologist working at the site. Speed estimates are made using the distance between the footprints, the animal's leg length, the pattern of the tracks, and other factors. However, when he saw how massive an animal Ankylosaurus was now, he found it extremely hard to picture it moving at a "decent jog."

The Ankylosaur was a dark turquoise in color with a pale cream underbelly. The animal behaved a bit like the Gigantosaurus earlier; it lumbered as it moved, staring at the jeeps with a dumb, cow-like stare. They could feel the thump of the animal's footsteps as it neared them.

"Don't worry." Drummond said. " The Ankylosaurs are easygoing creatures, they only react aggressively when threatened. I wouldn't play the Tyrannosaur roar now though." The Ankylosaur was very close now; it filled their entire view from the car with its bulk. All Gurmit could see was the deep turquoise of the bony scutes and shields. The Ankylosaur moved past them, swinging the tail club gently. The bony mass landed gently on the jeep's door and dragged lightly along its frame. The jeep vibrated slightly with the impact. The Ankylosaur sniffed the air as it went on its carefree, nonchalant way.

" Amazing." Sophin said, as the passing animal glanced dumbly at him.

After the Ankylosaur had departed, Drummond led the jeeps down further to the edge of the swamp. The ground was muddy here, and Drummond kept the convoy on dry land, avoiding the mud. The Brachiosaururs looked even larger from this distance. Truman noticed the Brachiosaurs were relatively silent compared to the crested Parasaurolophus; the pair only stopped eating once in a while to make a mournful bellow to one another before resuming eating. Truman also noticed that unlike the Parasaurolophus, the Brachiosaurs did not chew their food; instead, they swallowed it whole.

Truman turned hit attention away from the Brachiosaurs and looked at the swamp. The greenish water was surprisingly clear and still. Truman noticed a series of footprints in the mud along the edges of the swamp. The footprints were slightly damp and crumbling; indicating they were made some time ago. Truman identified the blunt three-toed footprints of the Parasaurolophus, the big elephant-like prints of the Brachiosaururs and a set of odd prints, something Truman had seen on some fossilized trackway before. The print had only two toes and was set lightly in the mud, he searched his mind for the answer-

" Do you also keep raptors in the herbivore paddock?" Truman asked, tapping Drummond on the shoulder.

" Of course not!" Drummond said. " We have a few small carnivores in one of our two jungles. But they are certainly not raptors."

" Then could you explain the footprints over there?" Truman pointed to the set of footprints.

Drummond snorted; he looked at the footprints for a while. " They are probably made by the Ornitholestes. They do come out here once in a while."

" No," Truman said. " These prints are way too big. Anyway, the Ornitholestes should leave three-toed footprints, not two-toed ones, like the raptors do."

There was a babble of voices over the intercom. A voice clicked on. " Dr. Truman, this is Professor Sophin. Can you tell the species that made the footprint."

" Yes." Truman said. " Deinonychus."
from Billy Macdraw, age 18, ....., ....., .....; October 30, 2000

T-rex because he eats other animals and kills things.
from chris b, age 10, Adeleaid, S.A, Australia; October 30, 2000

My favorite dinosaur is the Veleciraptor. Why because the veleciraptor one of greatest dinosaur that has every lived. He was known for how fast he ran. The veleciraptor was founded 144 million years ago.
from Shaina B, age 13, Chicago, ?, ?; October 30, 2000

My favorite dinosaur is a tyrannosaurus-rex because it is a meat eater and it has an awesome raor I like it's habbits and because he is so big
from Josh.b, age 9, middleville, Michigan, North America; October 30, 2000

brontosaurus. he is the tolist and he is a herbivore sow he wont eat me.
from ryan, age 7, riverview, fl, ?; October 30, 2000

t rex
from xa, age x, ax, xa, xa; October 30, 2000

T.Rex, he ripped the head off anatotitan in walking with dinosaurs
from Yonshun, age 4, ?, ?, Korea; October 30, 2000

T-Rex, it was the meanest, fastest, biggest , smartest, best smelling, coolest namest, most powerfulest, baddest and exalted above all dinosaursus.

He probally used his two clawed hands to show other dinosaurs obscene signs to tell them :"I am the baddest ##%^^% dinosaur around so don't mess with me of I will kick your @#$/"
from Marsha Lewis Davis N., age 16, Raffles City, Orchard, Singapore; October 29, 2000

Tyrannosaurus rex, powerful dinosaur.
from Lee Kuan Y., age ?, ?, ?, Singapore; October 29, 2000

T.Rex. COOL NAME
from fRANSIS l., age 6, PERTH, ?, ?; October 29, 2000

T - Rex He is the king of the dinosaurs.
from Pippa M., age 8, Sydney, NSW, Australia; October 29, 2000

T - Rex He is the king of the dinosaurs
from Jessie G., age 7, Sydney, NSW, Australia; October 29, 2000

Dinosaurs provide tremendous stimulation for the imagination. While we used to imagine the Mesozoic world as a landscape of sluggish swampdwellers, we now envision a world populated by a panoply of colorful, noisy, fast and cunning hot-blooded monsters. This is great for the Dinobiz, but does it make scientific sense? Did Dinosaurs operate under rules of physiology and evolutionary pressure substantially different from those of today? Did they develop markedly better solutions for dealing with their world than those that have evolved since? Let's look at the currently hot group, Dromaeosaurs, popularly known today as the Raptors. In movies, books and magazines these smallish theropods comprised the fastest and nastiest, and possibly smartest Dinosaurs ever. They were dressed to the nines in spikes and knives; cold-blooded homeothermic killers. While all members of this class had an impressive set of saw-edged teeth and formidably clawed forelimbs, it is the hypertrophied claws on the second toes of their hindlimbs that have transfixed our imagination. We are repeatedly told that these agile carnivores hunted in packs, slashing their large but lumbering prey to death in a series of back-foot blitzkriegs. Wait...does this really make sense? Did they really hunt in organized packs? Did they really use those curvaceous claws for slicing and dicing formidable foes into hors-d'ouvres sized snacks? I suspect it was more likely they rarely ate anything that couldn't have been nailed in a one-bite solo effort unless it was already dead. Heresy!!? Stop and consider this from an evolutionary standpoint. As Raptors were lightly built, they probably did rely on speed and agility. As they were bipedal, their back legs would have been essential to their survival. Almost any injury to such important structures would have been rapidly fatal to a creature relying on pursuit speed and kicking power. Want to hurt a back leg? Try to kick a large and angry herbivore that basically consists of thick skin over huge muscles. Ribs, pelvic bones, scutes, shields and flailing limbs would have made vital organs difficult targets. Aside from the likely humiliation of breaking a nail, they would have been at high risk for shattering a leg trying such tactics. Crippled dinosaurs didn't have a high likelihood of reproducing, leaving them losers in Darwin's evolutionary derby. Perhaps that is why they vanished by the mid-Cretaceous, giving way to the smash-mouth hunting tactics of the Tyrannosaurs. It is more likely that Raptors mostly used their razor-like teeth on smaller prey. If they did use claws, it was probably the impressive armament on their forelimbs which would have been much easier to control and less risky to survival if injured. So, what were those carpet cutters for? If there had to be a feeding function, consider other possibilities. They would have been useful for cutting through thick skin after their meal h! ad been immobilized by other means. They could have been used to rip aprt termite nests and beehives, or to dig up whatever resembled prairie dog towns of their era. If they had a taste for escargot, the claws were perfectly shaped for extracting the delicate morsels from their spiral shells.

I'm certain that every reader who has put up with me this far is thinking about the famous Velociraptor versus Protoceratops fossil where both died locked in mortal combat, proving the function of the slashing claw. Yes, the poor Raptor was using its foot, but probably as a defensive weapon! After all, it was probably trying to raid a nest for a meal of one-bite babies when it was attacked by one of those angry herbivores alluded to above. The large slashing claw on the cassowary is a good example of such a weapon evolving purely for defensive purposes. These birds are incredibly dangerous when trapped in close quarters although they are more likely to run away than take chances with their valuable legs in a battle. It makes sense to risk an incapacitating injury only if the alternative is being eaten.

If you are uncomfortable with these magnificent structures solely serving a protective function, what could be a more likely use? Why, sex of course. Many of the most extravagant and bizarre structures in nature are primarily used to attract a mate or to intimidate rivals. A set of large claws could be very useful for displaying to a potential mate or for ritualized combat. Look at the modern rooster, possessing impressive and dangerous spurs, but hardly famed as a fierce hunter.

While difficult to prove either way, it is easier to imagine Raptors having the coordination required for mating displays than the control needed for accurately kicking an opponent in a life or death battle. Despite their reputation for having relatively large brains, it is unlikely that such complex coordination would have been possible. No other animal has developed that style of hunting since, even if birds grab smaller prey with their feet and many animals do use their feet for defensive functions. While on the subject of brain function, I have to add that the concept of Raptors hunting in organized packs inspires incredulity. No reptile, or bird for that matter possesses the social structure to accomplish that and it is doubtful that Dinosaurs with relatively small brain-to-body mass ratios could have pulled it off. Swarming on common prey is observed with many animals including crocodilians, large lizards and vultures, although it isn't truly cooperative social behavior.! Finding fossils showing a group of Deinonychus with one large herbivore certainly doesn't prove or even imply social structure any more than finding a collection of flies around a dead rat.

One of the great joys of science is interpreting the evidence available. The Raptors are a fascinating group that truly deserves tremendous attention. All too often it seems that one view of fragmentary data becomes accepted as gospel and is repeated over and over as fact. The most obvious or exciting interpretation is not always the correct one. It is always fun to keep questioning, even if you get branded a heretic.

HA HA HA HA HA. NOW YOU KNOW HOW USELESS THE RAPTORS ARE! VOTE TYRANNOSAURUS REX !
from Insaniac, age ?, ?, ?, ?; October 29, 2000

My favourite dinosaur is the Tyrannosaurus, it's the fiercest terrestiral dinosaur.
from Bobbie W., age 10, ?, Texas, ?; October 29, 2000

Tyrannosaurus Rex. He is the bestest and most powerful dino.
from Kally O., age 9, Detroit, ?, America; October 29, 2000

T.RAX, is is the meanest dinosaur.
from Jamal, age 7, NY, ?, USA; October 29, 2000

T.rex, she's powerful
from Kasie.L, age 10, Alabama, ?, US; October 29, 2000

Erggh...Duh....I..liek da Taranosoreus Rex. Eff esss wery fierce.
from MR BEAN, age ?, HUH?, DUH?, WHAT'S FOR LUNCH?; October 29, 2000

12. Sauropods

" Excuse me," Wato asked Red. " But what do you work as?" The jeeps took a turn into a gate and halted, waiting for it to open.

" Me?" Red said. " Well, I work as the legal advisor to Verrand's investors." He gripped the wheel of the jeep lightly. " I'm here to see if this island is safe."

" Safe?" Horner said. " What if it isn't?"

" Then I will tell the investors to withdraw," Red said darkly. " Effectively shutting the company down." The gates slid apart and the jeeps moved on.

" So," Wato said uncomfortably. " Is this island safe?"

" Satisfactory, " Red said. " I'll have to see more."

The jeeps moved on past the gates and into an open field; the main paddock. The sun shone lower in the sky, casting long shadows everywhere. A river leading from the artificial lagoon flowed into a jungle to their left. Drummond stopped the jeeps abruptly a distance off some huge animals drinking from the river.

" Diplodocus." Drummond said. " This is our Diplodocus herd."

" It must be the one we saw back at the Tyrannosaur paddock." Truman said. " How many Diplodocus herds do you have?"

" About two." Drummond said. " That's a total of 12 animals."

Truman counted five animals; three big adults and two subadults. The Diplodocus were colored a yellowish brown and covered with fine hexagonal scales. A row of small spikes ran from the back of the head all the way back to the last quarter of the whiptail. The Diplodocus moved slowly, not moving except lowering their heads to drink from the river. One adult turned its long neck to stare at the jeeps with uncomprehending eyes. After a while, the massive animal ducked its head back down to drink from the river again.

" What's wrong?" Gurmit asked. " Don't they see us?"

" They do," Drummond said. " But they don't see us as a threat- they ignore just about anything except food and predators."

" I see." Truman said, studying the slow movements of the animals. " Are they exothermic?"

" You mean cold blooded?" Drummond said. " Well, yes. The Diplodocus keeps warm by standing in the morning sun, soaking up the heat with their large surface area. Due to their bulk, they keep the heat for just about the entire day- each full grown animal weights about thirty tons."

Truman knew this was true. Some people have recently suspected that certain dinosaurs had been homeotherms; they could generate heat internally and maintain a relatively constant body temperature higher than the average temperature of the environment. This had long been a point of contention for many paleontologists. In looking for clues to this mystery, paleontologists have considered such factors as posture, activity levels, and the ratio between predators and prey. The leading proponent of the warm-blooded theory is the renowned paleontologist, Robert Bakker. Since warm-blooded animals have so many advantages over cold-blooded animals, Bakker believes that dinosaurs could only have gained supremacy over the mammals if they were warm-blooded also.

Truman believed that sauropods like this Diplodocus were essentially poikilotherms; they were cold blooded. Homeotherms required a lot of energy from food to keep going, and sauropods had heads that were too small to obtain food to support such a lifestyle. Truman suspected the Diplodocus used a method called gigantothermy to keep warm; by being huge to maintain a relatively constant body temperature despite being cold blooded, large things, which have a lot of bulk in relation to their skin area, lose heat to the outside world much more slowly than do small things.

" Not all the dinosaurs in this island are cold blooded though." Drummond explained. " Big Rex is hot, so are the raptors. Gigantosaurus is a little cooler though." He looked at the Diplodocus. " Let's give them something to think about."

Drummond hit a button on the dashboard, and an extremely loud Tyrannosaur roar played from the jeep. It was shocking, like a cry from another world. The effect on the Diplodocus was immediate; they started bellowing and snorting in alarm. They turned their backs to the jeeps and started swinging their eleven-meter tails. One large adult swung its tail so rapidly, it cracked like a whip. The noise echoed through the plains.

" Woah." Gurmit said.

" Those Diplodocus can crack their tails fast enough for the tips to breach the sound barrier." Drummond said. " They use such noisy displays to deter predators and to attract mates- though now they are a little agitated, so I would guess they are trying to deter predators."

The intercom clicked on. " What the hell did you just do?" Red's voice came through, tinny. The Diplodocus made another crack with its tail. " What did you do?" The voice was angry.

" Nothing much." Drummond explained to everybody. " We usually play a recorded Tyrannosaur roar to get the animals moving if they are blocking the road." He paused for a while as the Diplodocus started to calm down. " It doesn't really hurt them."

The Diplodocus herd stopped snorting and bellowing. They turned and started making for a huge elevated metal container. As they moved, the tip of their tails gently explored the bodies of their herd mates.

" They're heading for the feeding container." Drummond said. " We import food to the island once every two weeks to feed the herbivores as the ecology of this island is simply insufficient to support such a large number of animals."

" I had thought so. " Truman said. He looked as the dinosaurs ducked their relatively inflexible necks to feed. Truman noticed the Diplodocus had a good amount of lateral movement with their necks, but an extremely limited range of vertical movement.

" Let's move on to the next herbivores." Truman started his jeep and led the convoy away from the Diplodocus herd.
from Billy Macdraw, age 18, ...., ...., ....; October 29, 2000

Godzilla because he is king of the monsters and he used to be o dinosaur. Tyrannosaurus because he will always be king!
from Stephen H, age 12, ?, ?, ?; October 29, 2000

tearadactall
from ?, age ?, ?, ?, ?; October 29, 2000

t.rex I think heis intersisting.
from Meshell p., age 9, texarkana, tx, u.s.a; October 29, 2000

T.Rex,because it is cool.I don't know why it is cool.
from s.c, age 10, Manly, Iowa, U.S.A; October 29, 2000

the dimetrodon and the spinosaurus.I don't know why.
from ?, age 9, manly, iowa, U.S.A; October 29, 2000

Muttaburrasaurus - because I like its nose, and its an Australian dinosaur
from Naszira U., age 7, Darlington, Perth, Western Australia, Australia; October 29, 2000

my favorite dinosaur is the t-rex because it is big and it is very interesting to learn about.
from Courtney T, age 11, Shavertown, PA, ?; October 28, 2000

T. Rex is my favorite dinosaur because it is cool. It is one of the biggest dinosaurs, and it is a meat eaters, and they are the meanest.
from Brandon, age 7, ?, Florida, ?; October 28, 2000

My favorite dinosaur is a tie between Parasauroluphus and Gryposaurus because I really like duckbills and have some neat ideas about them. I would like to see Gryposaurus on the list!!
from russell p, age 11, seattle, washington, usa; October 28, 2000

Stegasaurus - It can defend itself by swinging it's big tail and it was a friendly plant eater.
from jordon A., age 6, SanBernardino, California, United States; October 28, 2000

Old Blood rules!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
from firebird, age ?, ?, ?, ?; October 28, 2000

My favoriit dinosaur is the longneck because they are as tall as a girraf,and they are like trees and i like trees.
from SinceraeC, age 8, COARLSPRINGS, USA, FLORIDA; October 28, 2000

11. Logistics

Verrand was livid. His usually placid face was now contorted with anger. It was obvious to everyone that he was not very happy with the way things were turning out.

" Damn that Drummond!" He said. " I told him not to let them see Deinonychus, now they will be complaining that we are keeping extremely dangerous animals."

" You mean they would have killed and eaten us if they wanted to?" Sophin's voice came in over speakers.

" -But that isn't natural for predators…"

" Like anything is natural here…"

" They must have reached forty…no, fifty miles per hour…amazing…"

" See what I mean?" Verrand said loudly. The only time Greg had seen him so offended was during an animal escape episode. Greg decided to stay out of this one.

" It's not so bad." Calleja said. " Put it in perspective, it shows that the Deinonychus cannot escape- it's a true test of our engineering."

" That's true." Greg said. " This must have proved to them that no animal can escape. Anyway, they still have to see the herbivores, so let's wait and see."

They looked apprehensively at the monitors.

Kumalo finished his meal of Edmontosaur and rice quickly. Obviously, the kitchen had a surplus of Edmontosaur this week, for every meal on the menu had something to do with Edmontosaur meat. Edmontosaur rice, Edmontosaur stews, Edmontosaur steak and even Edmontosaur sandwiches. Kumalo shook his head; these animals have been extinct for over sixty five million years. So, what does man do not so long after he brings it back to life? He domesticates it and he eats it.

Kumalo took a flight of stairs from the restaurant down t the first floor, nodded at a guard, and headed to a metal door with the words "Animal Control" stenciled on it. He unlocked it with his keys and turned on the lights. It was the time to implement precaution.

This was the room where all the island's serious weapons were stored. Kumalo had fought long and hard for management to allow guns on the island, and it was obvious that his fight was not in vein. Kumalo selected six dull gray plastic tubes with a sling and slung them over his shoulder. He also selected a heavy, gunmetal tube with a pistol grip and a sight attached to it.

The gunmetal tube was actually a SMAW. A Shoulder Mounted Assault Weapon, a rocket launcher used by the US Marines to take out heavily fortified positions such as a bunker. This weapon would do just fine for taking down a rampaging 8-ton triceratops. The weapon had also been modified to accept and shoot custom-made, jumbo-sized tranquilizer darts. On normal occasions, the SMAW fired an unguided 82-millimeter rocket that carried a powerful High-Explosive-Armor-Piercing warhead capable of defeating forty centimeters of solid steel. While one man could fire this weapon, sustaining a suitable rate of fire was difficult to do, unless two people were handling the weapon; one to fire and one to load.

The gray plastic tube was another matter. It was an M-72A2 LAW, or a Light Antitank Weapon. Lighter and easier to handle than the SMAW, the M-72 was a one-shot, disposable weapon- once the weapon had been fired, it could not be used again. The M-72 allowed Kumalo to keep us a barrage of rockets after he had fired the SMAW, firing and throwing away the M-72s as he ran through them. The M-72 was also ridiculously cheap; selling at only fifty bucks per piece, which was one reason why management brought a large quantity of them.

Kumalo lugged all the weapons to his jeep in the garage; a normal gasoline powered version of the electric ones used by the rest of the park. This had brought him to odds with management once again, over the issue of upsetting the animals with the noisy internal combustion engine. But Kumalo stood his ground- and got his wish. He didn't like the idea of running of out batteries while attempting to outdistance a stampeding herd of five-ton animals.

Kumalo made another trip to the animal control room picking up some more rockets and tranquilizer darts for his SMAW. He locked up the room and headed for his jeep; carefully packing the rockets into a foam filled storage case. He locked up his jeep and walked back into the building, noticing the dark clouds of an offshore storm.

" Ah, Mr. Calleja?" A new voice came in over the speaker. " This is the Tramban, over."

Calleja sat upright. " Tramban, we have you, go ahead, over." It was a serious matter when a supply and logistics ship had to call right to the control room.

" The fuel you asked for will have to be delayed." The voice said. " We have received meteorological data from your pier crew that they are expecting a storm on our arrival."

" What's that?" Verrand said, still angry.

" That is the Tramban," Calleja said. " It brings fuel from a Brunei for our generators every five months. It's a tanker."

" Well, what's with the delay?" Verrand asked, looking unusually interested in the speaker.

" There will be a storm when they arrive at our pier." Calleja explained. " A ship of the Trumban's size cannot dock properly in a storm- hell, we may even lost the ship." He had seen a few cases of ships lost after colliding with the pier while trying to dock during the storm.

" What's our fuel state?" Verrand asked.

" Well," Calleja said, punching a few buttons. " We have enough fuel to power this island for an hour, the reserve tanks are full, they should last us about a month."

" I don't like the idea of using reserve fuel." Verrand said.

" Well," Calleja said, matter-of-fact. " You didn't want to invest money in building a sheltered harbor. Our docks have no storm-breakers, if you lose a ship, it'll cost you a lot in salvage, repair and-"

" Okay, okay." Verrand snorted. " Tell them to get out of here."

" Trumban, " Calleja said into the microphone. " You can wait the storm out, we'll tell you when the conditions are suitable, got it? Over."

The voice had a slight drawl. " Roger, Mr. Calleja. Trumban out." There was a click, and the speaker was silent.

" That was stupid." Verrand said, after a while.

" Don't fret too much about it." Calleja said. " We'll do just fine. You really should try to relax." He leaned back into his seat, puffing slowly on his cigarette.

" That'll kill you, you know." It was Kumalo; he walked into the control room, bringing in a bottle of Coke. " Here's the Coke you ordered." He gave the bottle to Calleja and started watching the monitors. " So," He said. " Did anything happen while I was gone?"

" As a matter of fact," Calleja ignored the scowl on Verrand's face. " The Deinonychus attacked our guests." He snubbed the cigarette and turned his attention to the Coke bottle.

Kumalo shook his head in disbelief. Calleja's nonchalant attitude shocked him. He remembered the Deinonychus were relatively indifferent to humans observing them until one of them escaped. Apparently, the escaped raptor had learned that humans were nice and easy to kill, and on recapturing and reintroducing it into the paddock, it had taught the other Deinonychus that humans were a viable food source.

Kumalo had noted such behavior. Highly social animals like the raptors could share ideas. Kumalo knew it wouldn't be long before all the Deinonychus in the paddock knew that humans were nice and easy to kill and eat. Kumalo had proposed that all the Deinonychus be replaced by new animals, as they were now all too dangerous. Like most of his opinions, they had fallen on deaf ears.

" They should be destroyed." Kumalo said. " The raptors learn fast. God knows what the Utahraptors learn when they see the Deinonychus attack people."

" You worry too much Richard." Calleja said. " The Utahraptors can't learn behavior from different species of raptor. Besides, so what if they do? They are under our control and can't do any harm." He took a deep swig from his bottle.

Kumalo scowled. He didn't like Calleja's attitude; he was far too complacent around animals he knew too little about. Besides, animals could learn behavior from different species. Humans taught chimps all the time. It wasn't impossible. Kumalo feared it wouldn't be long before the Utahraptors took the clue too.

" Where are they now?" Kumalo asked, looking for the blips that represented the jeeps on the map.

" They are out of carnivore country," Calleja said. " And moving into the main herbivore paddock."

They looked apprehensively at the monitors.
from Billy Macdraw, age 18, ...., ...., ....; October 28, 2000

stegasaurus. because he is so bony
from marissa r, age 4, wake forest, nc, usa; October 27, 2000

My favorite dinosaur is T-Rex because he has sharp teeth. My next favorite is Triceratops. My third favorite is stegosaurus. My next one is velociraptor.
from Christopher M., age 5, Philadelphia, Pennsylvania, USA; October 27, 2000

t-rex. because he is a flesh eating dinosaur
from bryce r, age 7, wake forest, nc, usa; October 27, 2000

My favourite dinosaur is the trex because it is scary and very cool
from shane r, age ?, ?, ?, ?; October 27, 2000

I like the dinosaur with the long neck because it is cool! Dinosaurs are pretty cool! Can you send me facts and news about dinosaurs? Thank you very much! I also like the Tyrannosaurs he is awsome to ! Paige thank you for thius website i really like it!
from Paige, age 10, Blairsville, P.A., USA; October 27, 2000

10. Big Raptor

" What do you mean the alarms went off?" Verrand said, suddenly worried.

" I mean, something touched the electrical fence surrounding the Tyrannosaur paddock." Calleja explained. " But the fences are still intact." He pointed to a screen. " I'll bet some Tyrannosaur just learned a painful lesson."

" I they ever learn." Calleja said. " The Deinonychus keep charging the fence at mealtime, take a shock, fall back, and never seem to mind."

"- If an animal like that gets out," Red's voice come in tinny over the speaker. " There'll be no stopping it."

" Big, with no natural enemies…."

" No, no stopping it…"

" My goodness, think about it…"

" Damn those people." Verrand scowled. "They can be so negative."

" Well," Calleja said. " It's their problem."

" Are they still going on about the animals escaping?" Greg came into the room. " But how? I thought we showed them." Greg believed that the island was fundamentally sound. Problems with it were point problems, like the problems with his DNA, like a protein that didn't fold or a gene that didn't switch on when it was supposed to. Those were simply isolated problems, not any serious flaw in the entire idea.

Similarly, he knew that the problems with this island were not fundamental problems. They were not control problems. Nothing as basic or as serious as an animal escaping. Greg found it offensive for anybody to believe that him capable of contributing to a system that such a thing could happen.

" You know what burns me?" Verrand complained. " Here we are, making one of mankind's most trilling fantasies come through- and those people are the first to see it. But instead of experiencing the wonder of it all, they go through the area like accountants, picking out every minor problem."

" Well," Calleja said. " You can't make them experience wonder." He lit up for another smoke. " However, I believe that this island is inherently dangerous."

" Oh great!" Verrand said. " Whose side are you on?"

" No, no, no." Calleja said, counting the points off his fingers. " Firstly, this island has all the problems of any game reserve, the land maintenance, logistics, and engineering."

" Secondly, we have all the problems of a major zoo. The enclosures, health and welfare, protection from pests, insects and animal control."

" Thirdly, we have the unprecedented problem of caring for animals nobody has ever cared for before." Calleja flicked some ash away.

" Oh come on," Verrand said. " It's not all that bad."

" Oh it is. Is just you are not here to see them." Calleja said. "The Gigantosaurs get sick often, the Ceratosaurs keep charging the fences and a alternating circuit breaker had to be installed to avoid killing the animals. Not to mention, the Deinonychus- "

" Let's not start on the Deinonychus, I am sick of hearing about the Deinonychus." Verrand said. " I know they are the most vicious and deadliest dinosaurs around."

" The point is," Calleja said. " These are control problems with the animals, not as serious as the ones Sophin had envisioned, but the fact it, we have control problems."

" Don't blame the animals." Greg said. " You've had your engineering delays too."

" But we all have to admit, what we are doing here is inherently hazardous." Calleja said, leaning back into his chair."

" Let's keep it in perspective." Verrand said. " Get your engineering right and the animals fall into place, after all, they're trainable."

It had been one of the core beliefs of this project; that the animals, no matter how exotic, would soon respond to the care that was been affected on them.

" It's that Sophin." Verrand said darkly, " He's behind it all. He was against us from the start. He has got his theory that complex systems cannot be controlled that and nature cannot be imitated. I don't know what his problem is. Hell, we are making a zoo here. World's full of them, and they work just fine. But he's going to prove his theory or die trying. I hope he doesn't frighten our investors into shutting us down."

Greg said. " He can do that?"

" No." Verrand said." But he can try. He can try to frighten the Japanese investors and get them to withdraw funds. Or he can make a stink with the Indonesian government. He can make trouble."

Calleja snubbed out his cigarette. " Well, we believe in this project." He started looking at the monitors again. " Let's see how it plays out." They listened to the voices over the speaker.

" Wow! That's Allosaurus…"

" That's right Gurmit…"

" Now let's move on the Ceratosaurus…"

" Now Ceratosaurus is one of our smaller carnosaurs…

They waited, watching the tags that represented the jeeps on the screen tensely, listening quietly to the conversation of the occupants.

" Where are they now?" Verrand asked after a while.

" They have done with the big carnivores, they're moving to the small carnosaur pens." Calleja said.

As the jeeps moved on, Wilson turned to Sophin. " I herd you speaking to Truman earlier." She said. " What is this chaos theory?"

" Perhaps I will start with a little history." He looked out of the window. "One of the earliest pioneers of chaos theory was Edward Lorenz. Lorenz was a meteorologist at the Maachussetts Institute of Technology. In 1960, Lorenz began a project to simulate weather patterns on a computer system called the Royal McBee. Lacking much memory, the computer was unable to create complex patterns, but it was able to show the interaction between major meteorological events such as tornadoes, hurricanes, easterlies and westerlies. A number represented a variety of factors, and Lorenz could use computer printouts to analyze the results. After watching his systems develop on the computer, Lorenz began to see patterns emerge, and was able to predict with some degree of accuracy what would happen next."

"While carrying out an experiment, Lorenz made an accidental discovery. He had completed a run, and wanted to recreate the pattern. Using a printout, Lorenz entered some variables into the computer and expected the simulation to proceed the same as it had before. To his surprise, the pattern began to diverge from the previous run, and after a few "months" of simulated time, the pattern was completely different. Lorenz eventually discovered why seemingly identical variables could produce such different results. When Lorenz entered the numbers to recreate the scenario, he the printout provided him with numbers to the thousandth position. However, the computer's internal memory held numbers up to the millionth position; these numbers were used to create the scenario for the initial run. This small deviation resulted in a completely divergent weather pattern in just a few months. This discovery creates the groundwork of chaos theory: In a system, small deviations can result in large changes. This concept is now known as the Butterfly effect."

" I think I understand." Wilson said quietly.

"The Butterfly effect, or more technically the sensitive dependence on initial conditions, is the essence of chaos." Sophin said. " In short, seemingly minor problems will develop into big ones. There are too many factors working and amplifying their effect." He paused. " Before long, your carefully planned system will go haywire, as I believe it will be the case with this island."

" And you are sure of this?" Wilson asked.

" Very sure." Sophin said, not smiling.

The jeeps came to a halt. " Here we are," Drummond said, pointing to a line of electric fences leading down a concrete path. " We can't drive in, so we will have to go it on foot." He got out of the jeep. " Try not to slam the doors, there's a Utahraptor in there." Drummond faked an evil grin as he saw the boy's eyes widen.

Drummond led the group away from the jeeps and onto the path. The electrical fences on this side were much shorter than the ones used to enclose the big carnivores; they were only about fifteen feet tall. " This is where we keep the smaller carnivores, " Drummond said. " Each paddock is about the size of a swimming pool." He kept moved along the fence for a while before stopping. " There they are."

Truman scanned the sparse vegetation in the paddock and saw them; three odd looking dinosaurs, about seven feet long. They were mainly colored a dull deep brown, save for a flaming crest that stood above its parrot-like head. The animals looked at them at squawked- a sound not too unlike a parrot. Truman noticed one of the animals wasn't like the others, it didn't have a crest.

" Well, I'll be…" Truman whispered. " They are Oviraptors."

" That's correct." Drummond said. " Initially, they were put in the main herbivore paddock as we thought they were too small to harm the animals. We were wrong, though they left the adults alone, they kept plundering the nests of the other dinosaurs, taking young and eggs." He looked at the Oviraptors. " So we built a paddock just for them. Unlike the other paddocks, this one simulates Oviraptor's original habitat."

Truman looked at the paddock and noticed Drummond was right. The enclosure lacked the abundance of vegetation Truman had seen in the others. This paddock was obviously trying to simulate a semi-arid landscape, with the harsh abundance of red rock and soil. The paddock looked misplaced among all the others.

" Do they plunder their own nests?" Red suddenly asked.

" No," Drummond said. " Though they cause fair bit of trouble among the nest of other dinosaurs, these Oviraptors are very good parents. They take good care of their young, bringing food to them, guarding them- hell, they even brood the eggs."

Truman nodded. Oviraptor was probably an omnivore, which is unusual for dinosaurs. It probably ate meat, eggs, seeds, insects, plants, etc. with its beak and powerful jaws. Oviraptor, meaning, "egg stealer", was thought to eat mostly eggs. In 1924, an Oviraptor fossil was found on top of some eggs, and people assumed that it had been eating the eggs. Recently, however, in Mongolia, paleontologists found some eggs containing fossilized embryos that were identified as embryonic Oviraptors. These eggs were very similar to those eggs found in 1924 that originally implicated the Oviraptor as a thief. If would seem that the Oviraptor fossil in 1924 was probably a parent of the eggs in the nest, and not an egg stealer but a nurturer.

One of the Oviraptors gave a squawk dipping its head to the ground, turning it from side to side. The crest flashed brighter as it begin to fill with blood. The Oviraptor without the crest did the same, dipping and squawking. The animals went on to do this repeatedly.

" Well, I'll be…" Truman said again. " It's a mating ritual."

" That's correct." Drummond said. " The males have a crest, and they use it for sexual display. These rituals can go on for hours- they don't seem to mind us watching them, but let's move on." He continued to lead the group down the path to another paddock.

The other paddock was slightly larger, and like most of the others, it was filled with vegetation. Truman could see a few animals staring back at them partially hidden within the plants. One animal was in full view. It bore a passing resemblance to the Oviraptors back in the other paddock. The animal had a long, slender snout, a graceful S-shaped neck and a long tapering tail that constantly made tiny adjustments as the dinosaur stood. Truman recognized the sickle-like, retractable claw was on the middle toe of each foot. They could only be-

" Velociraptor mongoliensis." Drummond said. " Fast, speedy predator from the Gobi. Though they are quite primitive by dromaeosaurid standards. Unlike the other raptors, Velociraptors are solitary, forming loosely knit packs to bring down big prey."

Truman had long suspected dromaeosaurids hunted in packs. They were well equipped for killing, with their sickle claws and ripping teeth. They problem was, most dromaeosaurids were small, such as Velociraptor, weighing in only at fifty to a hundred pounds, they lacked the bodies to bring down large prey. Thus the theory came about that raptors did hunt in packs. At one particularly distinctive locality, more than thirty-five Deinonychus teeth and skeletal elements from four Deinonychus individuals were found with the partial remains of one Tenontosaurus. The bones were found in fine overbank deposits and could not have been transported by fluvial processes. Thus the assemblage has been interpreted as the scavenged remains of a struggle between a large Tenontosaurus and a pack of the much smaller Deinonychus. The presence of both Deinonychus and Tenontosaurus bones at the site suggests that the prey animal and members of the attacking Deinonychus pack were killed during the struggle and were subsequently consumed. This gave compelling reasons to believe in the pack hunting theory.

This was different for Velociraptor. Truman and a series of other paleontologists have long suspected that Velociraptor mongoliensis was not as cooperative as its North American cousin was. Studies on Velociraptor brain cases have shown that the dinosaur did have a far less complex brain then Deinonychus, indicating it was less social. Even the fossil remains of a Velociraptor locked in combat reveled no Velociraptor teeth or any sign of other Velociraptors in the immediate area, indicating the dinosaur was hunting by itself.

" Now, they may not be the brightest raptors, but they are still extremely smart for a dinosaur" Drummond said as more Velociraptors started appearing out of the bushes, the biggest of them being no taller than Truman's thigh. "Velociraptor mongoliensis lived in a semi-arid region, not unlike the Oviraptors, but they seem perfectly happy with the standard habitat we have given them."

The Velociraptors studied the people for a while, looking intently before losing interest and resuming their routines. Some of squawked like the Oviraptors, though the sound was higher. It was like watching a group of scrawny, oversized running lizards.

" I'm bored, let's move on." Gurmit said, yawning.

The next paddock revealed a gory sight. Five Utahraptors rested around the bloody remains of a cow, looking around and pausing to hiss and snap at each other. Flies buzzed around the carnivores as they laid around the carcass, watching the people like the Velociraptors.

" They don't seem too interested in us. " Wato said. "Don't they see us?"

" They do," Drummond said. " But we don't mean everything to them. We are just some odd looking, noisy and smelly animals in their point of view- besides, they have just been fed, so they won't be hunting for a while." He looked down the path and suddenly looked tense. " Okay, this concludes the tour of the small carnivore paddock, now if you'll please follow me…"

" But there is still one more paddock left." Gurmit looked down the path. " What in there?"

"Deinonychus." Drummond said, tense. " But I don't think we have the time to see them."

" Why not?" Wilson said. " It's only fifty yards down that way."

" Well," Drummond looked edgy, almost nervous. " They conceal themselves, so you won't be able to see them anyway." He looked up the path. " We really should go."

" Why?" Sophin suddenly seemed very interested. " Is there a problem with the Deinonychus?"

" Of course not."

" I didn't think so." Sophin said darkly. " So, shall we see them?"

Drummond relented; he took a deep breath and led them down the path to the Deinonychus paddock, muttering something under his breath as they walked. He looked very tense.

" There's certainly something wrong with the Deinonychus." Sophin whispered as they walked.

" I think so too." Truman whispered back. " He's hiding something."

The group walked on, following the path through a dense bamboo grove. At the far side, they came to a double-layer chain-link fence twenty feet high, with spirals of barbed wired at the top. There was a electric hum along the outer fence.

Beyond the fences, Truman saw dense clusters of ferns, five feet high. He heard a snorting sound, a kind of snuffling. Then the sound of crunching footsteps, coming closer.

There was a long silence.

" I don't see anything." Gurmit whispered, finally.

" Ssssh."

Truman waited, several seconds passed. Flies buzzed in the air. He still saw nothing.

Wilson tapped him on the shoulder, and pointed.

Amid the ferns, Truman saw the head of an animal. It was motionless, partially hidden by the ferns. Two large dark eyes looked at them coldly.

The head was two feet long. From a pointed snout, a long row of teeth ran back to the hole of the auditory meatus, which served as an ear. The head reminded him of a large lizard, or perhaps a crocodile. The eyes did not blink, and the animal did not move. It's skin was pebbled and leathery, and was of a deep yellow color, with patches of black decorating it.

As Truman watched, a single forelimb reached up very slowly to part the ferns beside the animal's head. The limb was strongly muscled and had three grasping fingers. The hand, slowly, gently, pushed the ferns apart.

Truman felt a chill and realized that the raptor was hunting them-

The attack came suddenly from the front. Two charging raptors covered the ten yards to the fence with shocking speed. Truman had a blurred impression of powerful, three-meter bodies, long stiff tails, curved claws and long rows of teeth.

The animals snarled and leapt into the air, bringing their hind legs forward with the sickle-claws. Then they struck the fence in front of them, throwing off bursts of bot sparks.

The Deinonychus fell backward to the ground, hissing. A third animal dashed out of the ferns, striking the fence at chest level, throwing off another burst of sparks. Gurmit screamed in fright as the sparks exploded in front of him. The creatures snarled and leapt back into the ferns. Then they were gone, leaving behind a faint odor of decay and hanging acrid smoke.

" Holy cow." Gurmit said.

" It was so fast." Wilson said.

" Pack hunters," Truman said, visibly shaken. " Pack hunter for whom ambush is an instinct…Fantastic."

" I wouldn't call them terribly intelligent." Sophin said, shaking his head.

On the other side of the fence, they heard snorting among the ferns. Several heads started to poke out of the foliage. Truman counted seven. The animals watched them, staring coldly.

A native Indonesian man in overalls came running to them. " Are you all right?"

" We're okay." Drummond said.

" The alarms were set off." The man said as he looked at the fence. " They attacked you?"

" Three of them did, yes."

The man nodded. " They do that all the time. Hit the fence, take a shock. They never seem to mind."

" Not too smart, are they?" Sophin said.

The man paused. He squinted at Sophin in the afternoon light. "Be glad for that fence." He siad, and turned away.

Drummond led the group out quickly. From beginning to start, the attack could not have taken more than six seconds. He was till trying to organize his thoughts. The animals were astonishingly fast, he had hardly seen them clearly during the attack.

" Now we know the problem with the Deinonychus." Sophin said. " They like to actively hunt and eat people."

Wilson was deep in though. " I don't think so." She said suddenly. " Large predators like lions and tigers are not born man-eaters. These animals must learn somewhere along the way that humans beings are easy to kill. Only afterward do they become man-killers."

" Yes," Truman said. " I believe that's true."

" Well, these dinosaurs must be even more reluctant then lions and tigers. After all, they come from a time before human beings or even large mammals- existed at all. I wonder what they think when they see us. Why didn't they behave like the Velociraptors and Utahraptors? So I wonder: Have they learned, somewhere along the line, that humans are easy to kill?"

The group fell silent as they walked.
from Billy Macdraw, age 18, ...., ...., ....; October 27, 2000

T.REX
from Monicus, age 100000000, ?, ?, ?; October 26, 2000

8. Tour

The three jeeps moved silently and with little vibration, they were electric. " We use electrical jeeps to avoid disturbing the animals." Drummond explained through the radio. " We're now headed for the carnosaur paddocks, so hang on." The jeeps moved down the main road leading away from the facility and into the island. Truman sat with Gurmit with Drummond at the wheel in the lead jeep. Wato and Horner took the second jeep with Red at the wheel. Wilson and Sophin sat in the rear of the last jeep, with Kerwin driving.

The jeeps reached the fence surrounding the facility and stopped at the gate. A workman at a small guardhouse lazily hit a button, and the gates slid apart. As the convoy moved beyond the gates, Drummond cleared his throat and spoke into the radio. " This road is the exact opposite of the one you took in, it leads into the island- and toward the dinosaurs." He paused before speaking into the hands free set again. " We'll be seeing the carnosaurs soon- please keep in the car at all times."

The road led up a slight incline and through the rainforest. Dense vegetation surrounded both sides of the road. Truman started having paranoid delusions that a carnosaur might trap the convoy. He brushed them away, and tried to look for any signs of the first carnosaur paddock.

The vegetation cleared a little and the road became wider. Truman glimpsed a tall, no- nonsense structure of stretched wires running through concrete posts- it was an electrical fence, slightly smaller than the large perimeter fence he had seen earlier during the drive to the facility. Drummond cleared his throat again. " Ladies and Gentlemen, our biggest carnosaur, Gigantosaurus Carolinni."

Truman looked intently for the animal among the dense vegetation beyond the fence. He couldn't see anything for awhile and suddenly realized he was looking too low, for twenty feet above the ground, a slender head protruded from the plants. The jaws worked once and the Gigantosaur took a step forward, with an odd mixture of grace and bulk, exposing its massive body. Truman noted it wasn't terribly agile.

" We have two Gigantosaurs in this paddock, but I guess the other one isn't showing itself today." Drummond said. " This Gigantosaur is probably just investigating our intrusion." The Gigantosaur looked at the jeep convoy for a while, taking another step forward, stopping just two meters short of the fence. It lowered its head and stared at them with a cold, snake-like gaze.

" My God," Sophin said. " It's as big as a building."

" Don't worry too much." Drummond said. " We are perfectly safe here- besides, Gigantosaurus Carolinni isn't too bright, having one of the lowest body-brain ratio in carnosaurs."

" That's true." Horner said to Wato, in the second jeep. " Like Tyrannosaurus, Gigantosaurus Carolinni was probably a scavenger. In fact, these dinosaurs were so slow that you could outrun them if you wanted to!" Horner was in his favored position, dispensing information to the people who lacked it. He had been long scorned by paleontologists with the likes Truman for his ideas on how large carnosaurs behaved, but it looks like this island is about to prove to the world how right he was, and how wrong all the others were.

" It's that true, I thought Tyrannosaurus was…"

" Of course it is." Horner said. " Can you imagine such a beast running at forty kilometers per hour?"

Truman could see that Horner was telling Wato something in the other jeep, probably spreading misinformation on the dinosaurs. He frowned and contuined looking at the Gigantosaur, observing how the muscles rippled under the green, scaly skin. The six-foot long lower jaw opened slightly, showing a long row of triangular teeth.

Just then, the Gigantosaur gave a roar, it sounded more of a tight extended burp than an actual roar, but the noise was frighteningly loud. The Gigantosaur snorted, raised its slender head, and moved back to the cover of the vegetation.

" So, Gurmit." Truman was just making conversation. " What do you know about Gigantosaurus?"

" Err…" Gurmit paused. " He was a large carnosaur related to Carcharodontosaurus?"

" That's right Gurmit." Truman said. It never failed to amaze him when a five-year-old shouted "Stegosaurus!" He liked kids- it was impossible not to like any group so openly enthusiastic about dinosaurs. Truman used to watch kids in museums as they stared open-mouthed at the big skeletons rising above them. He wondered what their fascination really represented. He finally decided that children liked dinosaurs because they personified the uncontrollable force of looming authority. They were frightening and fascinating, like parents. And kids loved them, like they loved their parents.

Truman suspected that was why even young kids learned the names of dinosaurs. Saying these complicated names was a way of exerting power over the giants, a way of being in control.

" And like Carcharodontosaurus, Gigantosaurus was quite a dumb dino." Gurmit said. " Not like T.Rex."

" You like T.Rex?"

" Yes…"

" Don't you think that's a little too common?"

" Well…"

" Good, I like T.Rex too!" Truman said, and petted the boy on the shoulder. " Hey, the Gigantosaur is gone." He looked out of the window.

" Then we shall move on." Drummond said, he spoke into his radio. " And now we shall move on to our next animal- unarguably the most popular dinosaur in the world. Tyrannosaurus Rex." " Great." Gurmit said. " I hope he is better than that bozo."

9. Big Rex

" Tyrannosaurs arose late in dinosaur history." Drummond voice came in over the intercom. " Though the dinosaurs ruled for over a hundred and eighty years, Tyrannosaurs didn't arise till the last fifteen million or so. Tyrannosaurus Rex was the biggest, and deadliest of all."

The jeeps were still moving along the Gigantosaur paddock. " It will be a three minute drive to the Tyrannosaur paddock." Drummond explained. " The big carnivore paddocks take up a lot of area- about one and a half square miles each."

" Initially, we thought that Tyrannosaurs were solitary animals. " Drummond said into the radio as they drove along. " But after observing our two adult animals, we noticed that they cooperated in getting food and raising their young- speaking about their young. We have two baby Tyrannosaurs over here, all hatched in the wild. The other one you saw back in the clinic was only one of them, the other has been returned to the parents after tagging about two weeks ago."

Truman nodded his head. It was behavior that was long suspected with Tyrannosaurs- they socialized. People had long envisioned Tyrannosaurs as solitary animals leading solitary lives, the usual reptile model. After the discovery of multiple fossils of young and old Tyrannosaurs, such as Albertosaurus in a group, paleontologists like Truman had long been trying to change that view. Though they had made quite a good case by themselves, this island proved them beyond doubt. They were correct. From what he had heard, the Tyrannosaurus probably pair-bonded. They shared their food, raised their young together and probably stayed together for the rest of their lives, much like modern day birds like the stork.

" Tyrannosaurus is the bloodhound of the dinosaur world," Drummond went on. " With the best sense of smell in the fossil record. Tyrannosaurus has a nose at least four times more sensitive that that of the modern bloodhound- in fact, I reckon he could probably smell him from here."

Truman wasn't too surprised about the fact. CT scans of Tyrannosaur skulls revealed that the area used for smelling was not well developed, it was over developed. Truman had long suspected Tyrannosaurus used their great sense of smell for finding carrion or prey.

" He's correct." Horner said to Wato in the second jeep. " Scavengers like Tyrannosaurus used their acute sense of smell to detect rotting meat, following their nose to the carrion."

" I thought Tyrannosaurus was a hunter." Wato frowned.

" So do many people. " Horner said. " But we have various reasons not to believe so." He counted the points off his fingers. " Firstly, the lack of arms make it hard for Tyrannosaurus to catch its prey- you need arms if you are going to catch a chicken, you don't run after a chicken with your arms tied behind your back."

" Okay…"

" Secondly, with such small arms Tyrannosaurus risked serious injury if it did a belly flop while landing, in fact, I suspect even humans, running at a mere 25 kilometers per hour, could out run the animal- so don't worry if it tries to attack you."

" Thirdly, should Tyrannosaurus attack with its jaws," Horner said. " It probably risked losing teeth in an attack, meaning it couldn't use them to feed later. Not a tremendously good predatory adaptation."

" Fourthly, I did a cast of Tyrannosaur brain cases with another person called Roxton." Horner explained. " We realized that Tyrannosaurus had a brain similar to that of a amphibian, which showed he had a very primitive brain, and like amphibians, he could probably only see motion, so if you freeze, the Tyrannosaur will not be able to see you, again not a tremendously good predatory adaptation."

" You are changing a lot of ideas." Wato said.

" Of course, people have long held Tyrannosaurus as a predator." Horner said. " But I tell you- people are stuffed full of misinformation." He leaned back in his seat. " Like it or not, Tyrannosaurus was probably a big-time scavenger."

Truman saw Horner speaking to Wato again, probably spreading more of his misinformation. Truman shook his head and turned away. Horner was an extrovert; he liked holding talks and seminars about his extraordinary ideas. As what a fellow paleontologist had once said about Horner's ways: " He's more of a politician than a paleontologist, blessed with the ability to make people accept ideas based on little fact."

" Alright, we are entering the Tyrannosaur paddock." Drummond said. " Actually, we have pushed the feeding times three days back for you to see him feed. On other days, you probably won't see him at all."

" And why is that?" Truman asked.

" Because they have young to rear." Drummond said. " The babies are only about five weeks old, still too young for the parent to leave for long. Only the males leave to obtain food to support his mate and young. The female guards the nest, not leaving it till the babies are old enough."

The jeeps went stopped at the rise of a hill. They overlooked a forested area sloping down to the edge of the artificial lagoon. The sun lit the entire landscape of the island with a harsh late afternoon glare. In the distance, Truman could see a Diplodocus herd in the distance, standing at the water's edge, stooping down to take a drink. Truman noticed that the up and down mobility of the necks were limited, but the side to side movements had a great range. Watching the sauropods drink, it was possible to believe they had been transported back in time to another world millions of years back.

" Where is T.Rex?" Gurmit asked.

" He only comes when there is food." Drummond said. " As I said, we are making the feeding times earlier for you."

" Maybe he is hunting the Diplodocus," Truman said.

Drummond laughed. " Believe me, he would- if he could." He pointed out to the lagoon. " Sometimes he stands by the lagoon and stares at the sauropods, wiggling those tiny forearms of his in frustration. But T.Rex territory is completely fenced up and trenched up. They are hidden from view by the vegetation, but believe me, he can't go anywhere."

In the center of the field, a large cage rose, lifted by hydraulics from underground. The cage bars slid down, leaving a domesticated Edmontosaurus tethered to the center of the field. The Edmontosaurus honked plaintively.

" Are they going to eat him?" Gurmit asked.

" Yes," Drummond said. " We feed them Edmontosaurs once a month. They usually wait for a while before killing the Edmontosaurs, so please be patient, I don't think you will be disappointed."

They stared out the window.

"Look at them." Verrand said, watching the control room monitor. " Leaning out of the window, so eager. They have come for the danger."

" That was what I was afraid of." Kumalo said darkly. He twirled the keys in this hand on his finger and watched the monitors tensely. It was the first time any untrained personnel had been allowed to see the dinosaurs, and he felt some apprehension.

Richard Kumalo was a big man, forty-five years old and with a stern face. Raised in Kenya, and of mixed African-European parentage, Kumalo had served as a guide for African big game hunters, as his father before him. But since 1982, he had been working for conservation groups and zoo designers as a wildlife consultant.

In 1991, he had been working for a San Francisco company that was building a private wildlife park on an island in North America. Kumalo had determined what animals should be put together, and what animals should not, defining space and habitat requirements for the lions, elephants, zebras, and hippos. It had given him a name in the wildlife world; companies started hiring him to help design their habits. Kumalo had worked on TigerWorld in Kashmir, the Singapore Zoological gardens, and a list of other well known places.

A year ago, he was offered a job as a game warden of this place. He has accepted the job; the salary was excellent and the offer coincided with a desire to leave Africa. He was astonished to discover that this island was actually a collection of genetically engineered prehistoric animals.

It was of course interesting work. But Kumalo had learned to developed an unblinking view of wildlife- an unromantic view- that frequently set him at odds with management, particularly the little old man standing beside him in the control room now. In Kumalo's view, creating dinosaurs in the lab was one thing, maintaining them in the wild was quite another.

In Kumalo's view, some dinosaurs were too dangerous to be warranted to measures taken to keep them captive. In part, the danger existed because so little was know about the animals. Just only three weeks ago, who knew that taking a young Tyrannosaur for tagging would enrage the mother so much that she would ignore the electrical fences? It was a good thing Kumalo had moderately sedated her before they took the baby. Had the T.Rex been fully functional, it would have knocked the fence down and ended it all then. The fences had knocked out the female Tyrannosaur, but sustained major damage in her charge. After that incident, the cables in the fence had been replaced with thicker and stronger carbon steel ones and the chare had been increased another two thousand volts.

Kumalo was worried even more about the Deinonychus. Intelligent and fast, these pack hunters killed everything they could get their claw on- sometimes even their own young. Packed with switchblade claws in both feet, those dinosaurs could rip the cows they fed to them to shreds within one minute. Those animals also had nimble hands, and a great capacity for learning- that made them good cage breakers.

Every zoo expert knew that certain animals were likely to free out of their cages. Some like monkeys and elephants could undo cage doors. Others like wild pigs, were unusually intelligent and could lift gate fasteners with their snouts. But who would suspect the giant armadillo was a notorious cage breaker? Or the moose? Yet the moose was almost as skillful with its snout as an elephant with its trunk. Moose were always getting free; they had a talent for it.

So did Deinonychus.

Finally, as Kumalo feared, one of the Deinonychus finally escaped. It killed two workmen and maimed a handler before it was recaptured. After the episode, the Deinonychus paddock had been reworked with higher fences, electrified gates and electronic sensors to warn of an impending escape.

Kumalo wanted guns as well, and he wanted shoulder mounted missile launchers. Hunters knew how hard it was to bring down a four-ton bull elephant, and some of the animals here weighted five times as much. Management was horrified, insisting there would be no guns anywhere on the island. Kumalo had threatened to take his story to the press, and management relented. Guns were purchased and so were two rocket launchers, all kept in the animal control room downstairs. Only Kumalo had the keys to them.

Those were the keys Kumalo were twirling now.

" I am going downstairs." Kumalo announced.

Calleja, watching the screens nodded. " Hey, as long as you're up, get me a Coke, okay?"

Truman waited in the jeep, watching intently. The honking of the Edmontosaurs was became louder, more insistent. It started to pull at its tether, all the time looking around franticly.

" It's scared." Gurmit said. " It knows something."

" Anytime now." Drummond said, watching the field.

The leaves on a tree shook a little, and a few birds flew out of them. But still, Truman saw nothing. " He's here." Truman whispered.

The Edmontosaurs stood tethered thirty meters away from the nearest trees. The dinosaur must be somewhere among the trees, for a moment Grant could see nothing at all. Then he realized he was looking too low again: the animal's head stood twenty feet above the ground, concealed among the upper branches of the palm trees.

Sophin whispered over the intercom. " Oh my God… he's as big as a bloody building!"

" No," Drummond replied. " He's small- for a Tyrannosaur. That's the male, it's hunting for its family."

Truman stared at the gigantic head. The deadly dagger like teeth of the upper jaw visible from this distance. Somehow, the Tyrannosaur gave him a bigger sense of menace than the Gigantosaur earlier. The eyes of the Tyrannosaur studied the prey for a while with its eyes. The Edmontosaurs was honking franticly now, trying to pull free of the tether. " How long will he wait?" Truman asked.

" Not long, probably about-"

The Tyrannosaur sprang silently forward like a hunting cat; it didn't run, as if knowing the prey had nowhere to go. The smooth and rapid movement of such a huge animal extremely hard to believe, the Tyrannosaur was noticeably faster and more agile than the Gigantosaur earlier.

The Tyrannosaurus reached the Edmontosaurs after a few strides, it bit into the back of the animal, evoking a honk of alarm from the stricken animal. The Edmontosaurs collapsed, blood flowing from the gaping wound in its back. The domesticated hardosaur struggled as the Tyrannosaurus sank more bites into its hide. Finally, the predator held the neck of the stricken animal and bit into it, shaking the neck sharply with its head. The loud snap of broken bone reached them, carried by the wind. The Tyrannosaur started eating part of the carcass.

" Ladies and Gentlemen, Tyrannosaurus Rex." Drummond said.

The Tyrannosaur suddenly stopped eating. It looked up and started jerking its massive head about, nostrils flaring. " Looks like he caught a sent." Truman said, suddenly pausing when he noticed the Tyrannosaur was looking straight at him.

" Well," Drummond said. " He can smell us from here, he usually looks at us for a moment before he resumes eating- he's probably keeping a lookout for other predators out for his prize." He adjusted the microphone on his collar. " He will eat some of it and bring the rest back to his family."

But the Tyrannosaur didn't continue eating. It continued to look at them intently, sniffing all the time. It pointed its bloody snout at them and made an odd noise, a cross between a burp and a bark. It left the dead Edmontosaurs and started off the field towards them.

" Woah," Gurmit said. " What's it doing?"

" I think we are disturbing it." Drummond said, suddenly tense. " We have never brought so many jeeps in at once. We better leave to see our next dinosaur." He started the jeep. The Tyrannosaur was about twenty meters off their side by now. It started making the odd noise insistently, as if demanding a response.

Drummond started to move his jeep slowly, picking up speed as carefully as he could, trying to avoid too much attention from the animal. But the animal seemed focused on the second jeep, tailing it like a dog as it moved away slowly. Truman could see Horner and Wato staring back, wide-eyed.

The tail of the Tyrannosaur accidentally brushed the fence, causing a shower of sparks to erupt from the fence. The Tyrannosaur roared in pain, moving away from the fence. It stopped tailing the jeep, but continued calling for a while before it went back to the carcass, dragging it into the cover of the trees.

Wato looked at Horner. " I though you said he was a scavenger."

Horner was unfazed. " I didn't say he was a dedicated scavenger, he probably also hunted he came across a very easy meal, like a sick and weak dinosaur. As the Edmontosaurs couldn't go anywhere, he probably viewed it as a easy target."

In the last jeep, Sophin sat back in his seat. " Fantastic." He said.

Wilson wiped her forehead, she looked pale.
from Billy Macdraw, age 18, ....., ....., .....; October 26, 2000

Tyranosarusus Rex, he is the baddest.
from Francis L., age 5, Singapore, ?, ?; October 26, 2000

Tyrannosaurus Rex, it's big and powerful.
from Gaston L., age 8, Singapore, ?, ?; October 26, 2000

T.Rex
from Lilian L., age 9, Singapore, Singapore, Singapore; October 26, 2000

Nevermind, I found out ht a Kronosaurus is. I had never heard of it before!
from firebird, age ?, ?, ?, ?; October 26, 2000

What is a Kronosaurus?
from firebird, age ?, ?, ?, ?; October 26, 2000

Kronosaurus-becuse they look big and cool.because they've got a really long tail and can whip other dinosaurs with it.
from Benjie F., age 7, LaFayette, Georgia, USA; October 26, 2000

t rex
from garrett, age 5, arlington, texas, us; October 26, 2000

My favorite is Troodon, because it was the smartest known dinosaur, it was speedy, and it knew when to attack and when not to.
from John C, age 10, Lisbon, Connecticut, USA; October 26, 2000

My favourite dinosaur is Tyrannosaurus Rex he is very powerful.
from Li Mun H., age 14, Shanghai, Hiamun School, China; October 26, 2000

Tyrannosaurus Rex, He looks cute with his big head.
from Sherly T., age 5, ?, Arizona, USA; October 26, 2000

Hello everybody, I am Honky Tong, I am not Honkie Tong. We are two different people. I also like Tyrannosaururus Rex.
from Honky Tong, age 12, Singapore, Sembawang, Singapore; October 26, 2000

Good night everybody, Niponsaururs is my favourite dino, but I cannot find it here, so T-Rex is voted instead. He is my second favourite.
from Fugutiwa N., age 8, Kobe, ?, Japan; October 26, 2000
We've added Nipponosaurus to the list above.

Tyrannosaurus Rex becaussaroglnfhgdfhfddgdfagdddddd
from Tan Mi A., age 7, ?, ?, ?; October 26, 2000

This is the first time our scool has computer to internet. Many people wait to use, so i write short. I like T. Rax because it is the favourite dinosaur in my school. Now my school has dinosaur promotion.
from Ziao H., age 9, ?, Haimun Primary School, China; October 26, 2000

Yangchuanosaururs and Tyrannosaurus, is it true you have Tyrannosaurus name Sue?
from Tian B., age 9, ?, ?, China; October 26, 2000

Tyrannosaur Rex. It is my favourte.
from Fu L., age 8, Shanghai, ?, ?; October 26, 2000

Too many people in my school like Tyrannsaurus, I liek Paradecktil.
from Ong Su Fan, age 7, ?, ?, ?; October 26, 2000

T.REX, IT'S COOL AND SLEEK.
from Yovenne, age 9, Paris, ?, France; October 26, 2000

archyopterix, because it's the first one i remember ever seeing a picture of
from sean h, age 27, linton, indiana, usa; October 26, 2000

Rex, because the baby Rexes look very cute.
from Nari. S. R., age 10, Singapore, Singapore, Singapore; October 25, 2000

T-REXXXXXXXX
from ?, age ?, ?, ?, ?; October 25, 2000

Plesiosaurus and Ichthyosaurus.
from Bobbie T., age 9, ?, ?, ?; October 25, 2000

My favourite dinosaur is a triceratops and a pterasaur called ornithocirus beacause I like dinosaurs that can fly and have horns.
from M.Fauzan, age 7, Tampines, ?, Singapore; October 25, 2000

My favorite dinosour is T-Rex because it is the biggest and coolest
from Candis, age 11, Glen Lyon, PA, ?; October 25, 2000

Ankalosaurus because he was covred in armor and they are cool
from Robert D, age 8, Weathford, Texas, United states; October 25, 2000

Falossaraptor its cool
from ?, age ?, ?, ?, ?; October 25, 2000

Tyrannosaurus Rex, keep voting for him guys! We exceed the closest dinosaur by more than 120 percent!
from Tallier, age 10, ?, ?, Sudan; October 25, 2000

T.REX, cos it was the fastes meanest and biggest good carnivore.
from Ilosis.T, age 11, NY, ?, USA; October 25, 2000

Tyrannosaururs rex, it is the most powerful.
from Timon S., age 12, ?, ?, ?; October 25, 2000

T.REXES, THEY'RE GOOD!
from UNKNOWN PERSON, age ?, ?, ?, ?; October 25, 2000

T-Rex, he's the most powerful meat eater
from The Godfather, age 43/assumed, P10 98.7FM, ALL HITS ALL DAY, PERFECT TEN; October 25, 2000

Tyrannosaururs. It's the meanest dino. One Tyrannosaururs can take out an entire Utaraptor pack.
from Milye.M, age 9, Tyrannosaur Rulles, Tyrannosaur land, America the beautiful; October 25, 2000

I like any dinosaur that is as fat, lazy, useless and stupid as me, so the Raptors will be my pick.
from P. Krempl, age ?, ?, ?, ?; October 25, 2000

Old Blood

6. Domesticated Products

Drummond led the group down a flight of stars and out of the main building. He led the group across a road and into another building, which looked like a gigantic, oversized barn. A sign on a small personnel excess door read:

DOMESTICATED PADDOCK
Please Exercise Animal Protocol Spg-71A

" This is where we keep our domesticated animals." Drummond unlocked the door with a swipe of his card. "This building is two hundred meters long and fifty meters wide. We use it to house all of our domesticated products." He led the group in. The door beyond opened to a small, windowless office.

" The domesticated animals," Drummond explained. " Are actually a line of products for the average consumer. We created the tame, fast breeding Edmontosaurus for feeding our big animals, though they might have some value for farms though." Everybody except Sophin laughed.

" Our other products also include pigmy dinosaurs bred to be kept as pets." Drummond said. " We have already manufactured some of our species in this format; Velociraptor, Edmontosaurus and Leaellynasaura. All of our domesticated dinosaurs are specially made to survive in the human world, not the natural world. These are not wild animals, they are domesticated." He stole a glance at Sophin. " Anyway, enough talk, let's see our animals." He pushed another door open.

The inside of the building was well lit by natural sunlight and extremely spacious. It gave Truman a cavernous feeling, like being in an aircraft hangar. Numerous Edmontosaurs were kept in pens on both sides of the building. A concrete walkway ran in between the pens. The smell of dung was surprisingly absent. The some of the Edmontosaurs ducked their head out of the pens to pick at some feed.

Drummond went on to explain that the Edmontosaurs were the first in their line of domesticated products, and that the floor of the pens were lined with a special chemical to remove any smell of the dung and to kill the bacterial in it to avoid disease in the animals, but Truman was not interested. He looked at Edmontosaurs and noticed that, indeed, as Drummond had said, the animals were heavily domesticated. Horizon had obviously manufactured to be smaller, as all of them were only seven meters long at most. They were tame and quiet, having the mentality of a cow than that of a wildebeest. The animals also seemed perfectly happy at eating feed pellets for food.

" We keep half of our domesticated adult Edmontosaurus in this place." Drummond explained. " That's about a hundred and twenty adults."

" Where are the hatchlings?" Wilson asked.

" Well, we keep them in another building." Drummond said. " But they're quite fragile, so I don't think you can see them today, maybe when they're older."

Truman shook his head. Things were going too fast for him. No so long ago, such an undertaking was impossible, but now, just a few years, they have not only brought back prehistoric animals, but made their domesticated forms as well. Truman frowned, such technology was screaming forward too fast for its own good. He didn't like the looks of it.

" Now we'll bring you to see our line of pet products before seeing the wild animals." Drummond said. He led the group all the way to another personnel door at the end of the building and unlocked it. He led the group in.

The room inside was like a pet shop. Built in glass tanks lined the walls. A few of them contained a couple of infant dinosaurs, some of them contained a single animal. Truman immediately recognized the species; Velociraptor, Edmontosaurus and Leaellynasaura, the largest of them no bigger than a cat. They were genetically engineered domestic pets.

" Here are our dinosaur pets." Drummond said with a shark like grin. " All of them are actually modified versions of the original species. " He opened a tank and picked out a Velociraptor. " We have modified them to be docile and manageable- here, you can hold her." He handed the pigmy Velociraptor to Gurmit.

Gurmit held the Velociraptor in his arms. The Velociraptor was colored in splashes of black patters against a medium brown skin. The animal looked at him quietly, breathing slowly. The jaws worked once and Gurmit saw rows of tiny teeth. " Will she bite?" He asked.

" Oh no, " Drummond said. " They are quite friendly. Our pigmy dinos are actually dinosaurs modified never to grow to adult size, retaining their juvenile form. They are capable of breeding though. Actually, the basic idea is the same of those people who breed miniature dogs. He took the tame Velociraptor back. " But enough about the domesticated animals, it's time to see the real animals."

Wato could not believe what he was seeing. He remembered that day, twelve years ago, where Verrand had met him, introduced by a friend. Wato had been seeking new animals to display in his zoo.

" So," Verrand said. " I hear you are seeking for new animals to display in your zoo, I can do that for you."

Wato was puzzled. Getting a new animal was a long process. Usually, the animals came from another zoo of straight from the wild. A lot of red tape had to be crossed in order to obtain a new exhibit. Wato looked at Verrand and wondered what this old man had in store.

" You see, I have an idea for your zoo." Verrand told him. " I intend to make animals that are not available to any other zoo in the world available to your zoo."

" I do not understand." Wato said.

" I can't tell you the details Wato-san," Verrand said. " But it involves genetic engineering."

Wato wasn't too impressed. People have been talking about making genetically engineered animals for zoos for some time now. Perhaps the most talked about was a proposal to engineer a Lion-Tiger hybrid, something known as the Liger.

" I do not see anything too special about your request." Wato told him. " My country has been thinking about doing likewise."

" I am afraid what your country is going to do will be anywhere close to what we can do." Verrand said. " Can you promise confidentiality?"

" Okay," Wato said. " What do you intend to do?"

" To take a shot at the impossible." Verrand said. " To clone prehistoric animals."

Wato blinked in surprise, he didn't say anything.

" But the problem is," Verrand said. " My company has the technology, but we do not have the right researchers to do the project."

" And so you want me to provide you with the researchers to do it?" Wato said.

" Yes,"

" Why?" Wato asked.

" I know you are good friends with this person, Gregory Tremblay." Verrand said. " As you know, he is the best geneticist working on a project at your local university. I need you to convince him to quit the university and work for me."

Wato nodded, and started the ball rolling. He got Greg to work for Verrand, formed a group to invest in Verrand's company and did anything to help Verrand's project. Now, twelve years later, his investments were starting to pay off. His zoo was going to be the first in the world to feature dinosaurs.

He hoped it was safe.

7. Baby

Drummond led the group out of the Edmontosaur barn and to another building. The concrete building was relatively small compared to the rest of the buildings, but Truman could see that it was also designed to house animals, large animals.

" This is our veterinary clinic." Drummond explained. " We usually treat the animals in the field, but the babies and critically ill animal are sent here." He used his card to unlock the entrance of the building. " We always make sure the animals here are treated in the most humane manner."

The door opened to a room not too unlike a doctor's office. " This is the clinic." Drummond explained. " And this is our head veterinarian." Drummond introduced Dr. Kerwin, a tall, fair skinned man. " So, what do you have today?"

" Nothing much." Kerwin said. " Just a baby Rex in for a checkup and tagging." He put his gloved hand on the leathery snout of the small animal. " I have tranquilized him, he was a little too aggressive to work with." Kerwin explained.

The baby Tyrannosaur was no bigger than a cat; it lay on a metal tray, breathing shallowly. A dull green tag the size of a postage stamp was embedded in its thigh, almost invisible against its molted dark leathery skin. A pale ring of down covered the neck. Truman touched it, and was noticed it was warm.

" Hey," Drummond frowned. " Aren't you supposed to return the baby to the paddock by now?"

Kerwin shook his head. " There has been some delay in the delivery of the medical supplies." He said. " I can't let the baby back till I give him his vaccination shots- the vaccine has not arrived yet." He took off his rubber gloves and disposed of them.

" It must be one difficult job." Sophin said. " Taking care of prehistoric animals." " I assure you, it is." Kerwin said, not smiling. " You'll never know what to expect in these animals." He counted off his fingers. " The Gigantosaurs drink the lagoon water and get sick for some reason, the Edmontosaur population seems to have a flu bug running around. Infection is our largest problem."

" Infection? " Red looked shocked. " Could a person get sick?"

" Of course not!" Kerwin said. " Can you catch a cold from a zoo crocodile?" He paused. " I didn't think so."

" How about other problems." Sophin said. " Like behavioral problems?"

" I will be candid." Kerwin said. " I do not specialize in animal behavior, we have a game warden, but he simply keeps the animals." He petted the Tyrannosaur. " I believe we are hiring a animal behaviorist, somebody called Wilson."

Wilson widened her eyes in surprise; she was shocked, but not surprised. Verrand had made her sign a contract with him before he funded her through university and into her expeditions to the savanna. She had expected he would employ her someday, but she had never expected to be hired here, to study real life dinosauria.

It was a chance of a lifetime.

" Now that you know." Drummond said. " Verrand was going to hire you after this tour, he wants you to be the island's animal behaviorist." He explained.

" Now that you are here, " Kerwin said. " I might as well be a little more transparent and run through all of our behavioral problems." He started counting off his fingers again. " The Ceratosaurus tend to bite one another out of the blue, the Gigantosaurs run through a phase of unexplained coprohagia one in a while and fall sick after eating their feces." He paused uncomfortably before continuing. " However, our largest problem is with the Deinonychus; they breed alright, but have a bad habit of killing their young sometimes. In fact, infant mortality within the breeding Deinonychus is around seventy five percent, sixty percent of it related to infanticide."

Wilson didn't share Kerwin's puzzlement over these events. Animal behavior usually seems alien and offensive to lesser-informed humans. Many a myth rose from inaccurate observations of such behavior. In some cases like the dolphins, it helps them by endearing them to the public eye. But in most cases, it proved to be the undoing of the animal. Wilson knew of many examples:

The wolf was once a much-maligned animal. In the western world, people feared and hated wolves, and this legacy is reflected in stories such as Little Red Riding Hood and The Boy Who Cried Wolf. In these popular children's tales the wolf is made out to be a marauder and a killer of livestock and people.

People have long practiced population control and extermination of wolves. At times, governments have paid a sum of money, called a bounty, for each animal killed. In Canada, the first bounty payment was made in Ontario (then Upper Canada) in 1792. Eventually bounties were paid in every province and territory inhabited by wolves, but by 1973 they had been discontinued at the provincial and territorial level, except in the Northwest Territories. When Ontario repealed the wolf bounty in November 1972, wolves damage the Wolf Damage to Livestock Compensation Act, which makes cash payments to farmers whose livestock, or coyotes replaced it. In Quebec, bounties are occasionally offered by certain municipalities; however, since 1984 trapping and hunting of wolves is only allowed during part of the year. British Columbia and the Prairie Provinces now use traps and poisons to kill wolves inhabiting areas where they may threaten livestock or game populations.

Wolves prey on big game animals and help to control their populations. Where wolves are absent (for example, Anticosti Island, Pennsylvania, and Wisconsin), white-tailed deer have overpopulated their ranges and damaged forests. Food shortages and mass starvation of deer during the winter sometimes follow.

In short, Wilson didn't trust the casual observer to make a good judgment on any animal. Though Kerwin seemed so mystified by such the Deinonychus' behavior, she suspected she had already found the answer, without even seeing the dinosaurs for herself.

The Deinonychus were among the most intelligent dinosaurs, and one of the most ferocious. Both traits demanded behavioral control. Millions of years ago, in the now vanished Cretaceous world, their behavior would have been socially determined, passed on from younger to older animals. Genes controlled the capacity to make such patters, but not the patterns themselves. Adaptive behavior was a kind of morality; it was behavior that had evolved over many generations because it was shown to succeed- behavior that allowed members of the species to cooperate, to live together, to hunt, to raise young.

But on this island, the Deinonychus had been re-created in a genetics laboratory. Although their physical bodies were genetically determined, their behavior was not. These newly created raptors came into the world with no older animals to guide them, to show them proper raptor behavior. They were on their own, and that was just how the behaved- in a society without structure, without rules, without cooperation. They lived in an uncontrolled, every-creature-for-himself world where the meanest and nastiest survived, and all the other died.

Zoo animals frequently could not care for their offspring, because they had never seen it been done. They would ignore their infants, or roll over and crush them, or simply become annoyed with them and kill them. Like the all animals raised in isolation, the Deinonychus were not fully functional.P> " Dr. Wilson?" Drummond cut into her thoughts.

Wilson shook her head. " Huh? What?"

" You better get onboard." Drummond pointed at one of the three jeeps in the building's garage. " We're going to see the animals."
from Billy Macdraw, age 18, ....., ....., .....; October 25, 2000

T.rex, it can shred any other dinosaur to hamburger.
from Ornious, age 12, Dubai, UAE, ?; October 24, 2000

Dryptosaurus-with its predatory behavior and hooked claws, it would have made a fierce and aggressive opponent.
from Adam K, age 13, Gold Canyon, Arizona, USA; October 24, 2000

Tenontosaurus because it's a cool duck-billed dinosaur
from John G, age 17, Poopville, CA, USA; October 24, 2000

T.Rex....NOW!
from Saururs, age 12, ?, ?, ?; October 24, 2000

Old Blood

5. Control

" And this is where we control the entire facility from." Drummond used his card to unlock the door. He led the group in.

The room resembled the control room of an airport. Numerous monitors decorated the interior of the room. One big screen displayed a map of the island, with many numbered and coded dots moving on it. A man sat at the console speaking to Verrand.

" This is Stephen Calleja, our facility's head engineer. " Drummond introduced the person at the consoles, a big, tense, cigarette smoking man in his forties. " He will show you how we control the facility- and all its animals from here." Drummond stole a glance at Sophin.

" Do you want to know about our control mechanisms? " He snubbed his cigarette and reached into his pocket for another one. " We have unbelievable control mechanisms over here. "

" Such as?" Red asked.

" Such as animal tracking." Calleja explained. " He hit a button, and a jagged blue line lit up. " This is the path taken by the male Tyrannosaur in the past twenty four hours." Calleja said. " It allows us to get a sense of the his home range after a while."

" How about the path taken by his mate? " Red asked.

Calleja hit another button and a large red line lit up. It resembled a tight circle, but the line broke the circle and started to resemble the path taken by the male towards the end. " She usually stays close to the small Tyrannosaur, which has yet to leave the nest, while the male brings food for the both of them. But not today." He pointed towards the end of the red line. " She broke her daily range today."

" And may I know why?" Sophin asked.

" Because," Calleja said. " We have taken the baby Tyrannosaur out of the paddock and to our animal clinic to be tagged and to receive his shots. Obviously, mama is a little worried about it."

" And can we see the path of the baby Tyrannosaur?" Red asked.

" Well, not really. " Calleja said. " That's why we are tagging the Tyrannosaur. This system tracks the radio tags on the animals, not the actual animal itself."

" Let me get this clear, " Sophin said. " You have no idea of tracking the dinosaurs except by tagging them? Has the thought ever crossed your mind that there may be some untagged dinosaurs running around, before you can collect them and tag them?"

" I see what you mean." Calleja said. " But we have two solutions to this problem. The carnivores are kept in separate paddocks, divided by species. So if there is, say… a new untagged infant Allosaur. It will be in the Allosaur paddock; meaning it will be a matter of time before we find it."

" And the second solution is?" Sophin asked.

" We rig multiple sensors all over the island. Video monitors, heartbeat sensors, motion sensors and such." Calleja said. "These are usually directed at the nesting sites of the animals; the computer will take in information from the sensors and attempt to match it to the position of the closest tagged animal. If the information the sensors get do not match the location of the tagged animal, the computer will notify us."

" I see." Sophin said. " How accurate?"

" Let's say if you look at the position of the animal on the map and drive there, " Calleja paused dramatically. " You will find the animal right there."

" Is there anywhere the sensors do not cover? " Sophin asked again.

" Well, certain areas like the river and the rainforest tends to screw up the sensors. " Calleja said. " But we cover up to 92 percent of the island- that's forty two square miles,"

" Does the computer ever make a mistake?" Sophin asked.

" Sometimes it messes up the babies," Calleja admitted. " But we don't sweat that, the babies usually stay in the nest or near their parents." Calleja flicked some ash into an ashtray. " Furthermore, we usually tag the infants as soon as possible."

" Good, " Sophin said. " But how can you be sure of that?"

" Very sure." Calleja said. " The computer tallies the results every five minutes and prints it out on a screen. Any untagged animal will show up in this search." He pointed to a screen.

Tally Criteria: Untagged
Species__________Expected_____Found________Total

Velociraptor_______3___________3_____________ 3
Deinonychus_______4___________4_____________4
Gallimimus________1___________1_____________1
Edmontosaur_______2___________2_____________2
Total ______________10__________10____________10

" As you can see," Calleja said. " Any untagged animal will show up in a search. All the untagged animals you see here are all newborns, still too young to tag; but we will tag them soon enough."

" Let's say I think some of the untagged animals here are actually adults." Sophin said. " How do you prove me wrong?"

Calleja snorted. " Okay, I can always use the video monitors to see all of the untagged animals." He flipped through a number of pictures on another screen, all showing infant animals. " As you can see, all our untagged animals here are newborns."

" Fine, but what if there are some untagged animals in the eight percent of the park you can't track with your sensors? What do you do about them?" Sophin asked.

" Simple, the eight percent of the park also includes the area outside the animal containment areas. That leaves five percent of area for which the animals can hide in- and we will know if there is any animal in that five percent of area."

" What do you say that?" Sophin asked.

" Well, for the simple fact that this five percent of area is actually a thin zone following the river." Calleja explained. " It really doesn't give a lot of space for an untagged animal to hide, given the daily range of the dinosaurs."

" Well, how many dinosaurs do you have on your island then?" Sophin asked.

" That depends on how many hatchlings we have, but we do a tally every hour." Calleja hit a button. "Here's all the dinos on the island now, tagged or untagged."

_________________________________________________ Total Tally


Species/Expected/Found

Tyrannosaurus /4/4/
Gigantosaurus /2/2/
Allosaurus /4/4/
Velociraptor /23/23/
Deinonychus /14/14/
Gallimimus /21/21/
Edmontosaurus /16/16/
Diplodocus /12/12/
Triceratops /15/15/
Carnotaurus /5/5/
Compsognathus /45/45/
Stegosaurus /4/4/
Brachiosaururs /2/2/
Ouranosaurus /10/10/
Oviraptor /9/9/
Ankylosaururs /3/3/
Ornitholestes /12/12/
Parasaurolophus /10/10/
Heterodontosaurus /18/18/
Utaraptor /6/6/
Ceratosaururs /5/5/
Leaellynasaura /17/18/

Total/257/258/

" Well, what do you know." Calleja said. " It looks like we have one more newborn Leaellynasaura." He started hitting buttons. " Let's confirm that for you." A video screen popped up, showing a small, brown, wrinkled bundle of skin moving slowly within a nest, calling repeatedly. An adult Leaellynasaura bent over to tend to it. " Convinced?" He looked at Sophin.

" Just one more question about this." Sophin said. " How exactly does the computer pick out the species from the sensors anyway?"

" The computer takes the overall shape and appearance of the dinosaur in the sensors, " Calleja flicked more ash away. " And checks it with its database, trying to find a match."

" How about physical containment?" Red asked. " Can the animals get out of their enclosures?"

" Absolutely not." Calleja said. " These are expensive animals, we take good care of them. But, since you want to know…" He hit another button, and red lines started appearing all over the map on the large screen. " These are the electrical fences that keep the animals in. The perimeter fence closes off the entire island, while smaller fences close off the animals to keep them from us." Calleja pointed at a few big red boxes on the map. " As you can see, we divide the carnivores by species, while the herbivores share one large paddocks- In fact, the only carnivores we keep in the herbivore paddock are the Ornitholestes and the Compsognathus. The fences carry at least ten thousand volts- the animals quickly learn not to go too close to them."

" Are there any other methods of containment." Red asked.

" Yes, " Calleja said. " We enclose all of our enclosures with moats, all of them are at least fifteen feet deep and water filled." Calleja paused to flick more ash. " All of the enclosures are linked commonly by a central artificial lagoon that provides the animals with water, but the lagoon is forty feet deep and divided by dykes with electrical fences above." He looked at the map. " The physical containment system is sound, we haven't had a single animal escape yet."

" What if an animal did get out?" Red said.

Calleja snorted, and snubbed out his cigarette.

" Just hypothetically," Red said. " What if one animal did get out?"

The dark skinned man Truman had seen earlier cleared his throat. " Then we'll go out and get it back. Tasers, electronets, tranquilizers and such. Should the situation get out of hand, we have numerous firearms and military equipment."

Drummond introduced the dark skinned man, Kumalo, the animal control specialist.

" And if one did get off the island?" Red asked.

" That's not possible." Calleja said. " The mainland is at least 90 kilometers that way, it is impossible for the animals to reach there by themselves."

" How about the control system itself?" Sophin looked at the monitors. "Could anybody tamper with it?"

" I don't see how." Calleja said. " This system is isolated from the rest of the world since we completed building the control program about four months ago. Nobody can tamper with it online from outside." Calleja leaned back in his chair. " Everything is independent of the outside world in every way. Independent power, independent system. Nobody can tamper with it. " Calleja looked at Sophin. " The animals here are effectively isolated from the rest of the world."

" Let me guess." Sophin said. " This system so good, that you have no problems at all?"

" None of the sort." Calleja said. " We have lots of problems, but they are all minor bugs, it is technically impossible not to have them. We have ironed out most of them though."

" What is technically impossible," Sophin said. " Is the isolation of the animals done here."

" Oh great." Verrand snorted and turned away.

" And why is that?" Calleja asked.

" Because of what you are trying here." Sophin said. " You are trying to re-create nature, and to isolate it here from the rest of the world right?"

" Yes…"

" Well, from my point of view," Sophin said. " Such isolation is impossible it simply cannot be done. The mathematics is self-evident. You cannot successfully hope to create nature, and then to isolate it here."

" Why not, after all, there are zoos?"

" Zoos don't isolate the physical environment," Sophin explained. " They modify it slightly. And even so, the animals escape with regularity. But a zoo is not a model for this place. You are hatching your animals, and then letting them roam in a restricted patch in the wild. You are trying to recreate nature, with such high stakes."

" I don't understand." Red said.

" Alright, save for the air that flows through this place, everything here is supposed to be isolated. The animals are supposed to be isolated, never to escape and mix with the greater ecosystems of the world, right?" Sophin said.

" And they never have." Verrand said.

" Such isolation is impossible. " Sophin said. " It cannot be done."

" It can, such isolation is done all the time."

" I am sorry," Sophin said. " But I do not understand what you say. Some animals have probably escaped from their enclosures by now. It will only be a matter of time before they escape this island."

" You arrogant little snot." Verrand stood, and walked out of the room.

" Maybe you don't understand." Calleja betrayed a tinge of annoyance. " But we are no fools, we understand that the animals have been gone for a long time, and if they ever did get out in the wild, some of them will grow unchecked, because they have no natural predators to check their growth. " He reached for another smoke. " We understand that, and we have built in numerous measures to prevent that from happening."

" Maybe I don't understand." Sophin said. " You are selling these animals to zoos, right? How can you make sure it doesn't happen there?"

" We'll make sure it doesn't" Calleja said. " Now, I really need to get back to work, any final questions?"

" Okay, can you generate a graph of all the heights of your animals?" Sophin suddenly " Say, the Velociraptors?"

" Sure," Calleja seem glad the inspection was about to end. " The computers can actually tell the height of the animals from the video monitors and turn it to a graph." He started hitting some keys.

_______________________________________________________

Velociraptor height graph

Num. Of animals

7----------------------------------------------------------*
6---------------------------------------------------*
5----------------------------------------------*
4-------------------------*
3----------*--------------------------------------------------------------*
2---*
1*---------------------------------------------------------------*
---40---42---44---46---48---50---52---54---56---58---60---62---64 Height/cm
________________________________________________________ " As you can see," Calleja explained, " If you link all the points up, you get a double humped curve. This is because we introduced the animals in two batches, therefore we get two height maximums."

" You'd expect that kind of graph." Sophin said

" Well, yes." Calleja said. " I don't see why not, any other questions?"

" No," Sophin said. " I've learned what I need to know."

" Good." Drummond said. " Then let's continue with out tour, you will be seeing the animals next."

As the group walked out of the control room, Truman looked at Sophin and said. " It looks like a pretty good system to me, I don't see how the animals could get out."

" As a matter of fact," Sophin said. " I am quite sure some of the animals have escaped by now."

" Wait a minute." Truman said. " You actually think some animals are ruining free in the park now? How? They watch the animals all the time."

" It's obvious." Sophin said. " It's just a matter of assumptions."

" Assumptions?" Truman frowned.

" In a sense this island is like the real world." Sophin said. "
The animals breed. But from the population graph I have just seen

, it demonstrates something terribly worrisome about this island." " And what is that?"
" The graph shows an unnatural population, one introduced in batches by man." Sophin said.

" Yes, and I'll expect a graph like that."

" But Dr. Tremblay told us earlier that the animals can breed, so we should expect to get a curve of a breeding population, why isn't that so?" Sophin said.

" I am still not too clear." Truman said. " It could be due to a number of reasons; high infant mortality, low growth rates, maybe it's the way they are engineered, it could be anything."

" Could be." Sophin said. " But I am quite sure I can say something is wrong with this island, graph or no graph. The tour will make everything clear."
from Billy Macdraw, age 18, ....., ....., .....; October 24, 2000

I like the T-rex beacuse he can rip apart other dinos and he could rip up Crista for me.( She is a big bully at my school!!!)
from whit h, age 9, st. paul, MN, USA; October 24, 2000

Ultraraptor
from Boaz S, age 7, San Jose, ?, Costa Rica; October 24, 2000

Allosaurus, it's name means "Different lizard
from Tyler K, age 8 years, Sinking Sping, Pa, U.S.A; October 24, 2000

The Iguanodon is my favorite animal because it's a peaceful dino and only eats plants.
from Rachel S., age 9, San Antonio, Texas, United States of America; October 24, 2000

Bactrosaurus-because he's 20 feet high .
from Aristia and Monique, age 10, Harvey and New Orleans, Louisiana, United States; October 24, 2000

T-RAX is my favourite dianosour because it eats other dianosours.
from ARSALAN R., age 7, HOLLISWOOD, NY, USA; October 23, 2000

the T rexis my.Why i like him is because he is the dino king
from raymond m., age 10, anchorage, alaska, u.s.a; October 23, 2000

my favorite dino is a RAPTOR i like it because its brave it moves fast it could cut almost anything open with a toe neal and its cool and slik and just the right size
from GL, age 11, stamford, ct, united states; October 23, 2000

parasaurolophus -it swims in water. it has a horn on its head that makes noise.
from kate m, age 4, tosa, wi, ?; October 23, 2000

Liopleuridon - because it's what I would like to be! It looks fab to be so big and fierce, and it fascintaes me by being so huge - one of the biggest dinosaurs (OK, yes, I know it isn't technically one at all). And the BBC programme "Walking With Dinosaurs" had such a marvellous animated one - it was too real for words!
from Lorna N, age 26, Surbiton, Surrey, UK; October 23, 2000

triceratops. because it has three horns, and its a dinosaur, and it eats plants.
from travis, age 5, pgh., pa., us; October 23, 2000

T. Rex- Because he's loud and eats other dinosaurs.
from Timothy S, age 5, E. Northport, NY, USA; October 23, 2000

Old Blood 4. Chaos Theory

On the way to the control room, Truman said. " Mr. Sophin, you do not seem too impressed by all this."

" So you've noticed." Sophin said, not smiling. " I have had my problems with Verrand."

"What problems?"

"Well, for starters, I think this whole place is an accident waiting to happen." Sophin said, not smiling.

Truman tilted his head, puzzled. " Why do you think so?"

" Okay, do you know anything about the Chaos theory?" Sophin asked.

"No." Truman said.

" Nothing, not even strange attractors?"

Truman shook his head.

" How about a nonlinear equation?"

Truman shook his head again. " Okay." He said. " Let's go back to the beginning." He paused, staring at the ceiling. " In the beginning, Physics has had great success at explaining certain kinds of behavior; a spacecraft going into space, the path of an artillery shell and such. Such things are called linear equations, any physicist can solve them or mathematician- in fact, we've been doing it for about a hundred and fifty years. "

"Okay…" Truman tried his best to follow.

" But there is another kind of behavior that physics handles badly. Anything that has to do with turbulence; Air flowing across an airplane wing or water from a tap for example, are nonlinear equations. These equations are very hard- in fact, they are usually impossible to solve. Physics has never really understood this brand of science."

"Chaos theory grew out of attempts to make computer models of weather systems in the 1960s. Weather is a big complicated system, namely the earth's atmosphere when the land interacts with the sun. The behavior of this big complicated weather system has always defied understanding. So naturally we couldn't predict weather. And what early researchers discovered from computer models is that, even though you could understand it, you still couldn't predict it. Weather prediction is absolutely impossible. This is because the behavior of the system is sensitively dependent on initial conditions.

"You've lost me." Truman said.

" Okay, let's say we fire a shell from a gun, and mark the spot at which the shell lands. Now, if we duplicate the conditions of the initial shot and fire a second shell, what will happen?" Sophin said.

" Well, the round will land in almost exactly the same spot." Truman said.

" Correct, " Sophin said. " That's linear dynamics."

"Okay"

" But if I have a weather system and start it up at a certain humidity, a certain temperature and a certain wind speed- and if I repeat the experiment with almost the same conditions, the second system will wander off and become very different from the initial results the first system came up with. Thunderstorms instead of sunshine, that's nonlinear dynamics, they are sensitively dependent on initial conditions, small differences become amplified."

" I think I see." Truman said.

" The shorthand is the butterfly effect." Sophin said. " A butterfly flaps its wings in Peking and the weather in New York is different."

" So is chaos all just random and unpredictable?" Truman said, " Is that it?"

" No," Sophin said. " We actually find hidden regularities within the complex variety of the systems behavior, that's why chaos has become a very wide theory used to study anything from the stock market to a rioting crowd. In any sort of complex system where there is chaos and unpredictability, we can find an underlying order, okay?"

" Okay," Truman said, " But what is this underlying order?"

" It is essentially characterized by the moment of the system within phase space."

" Jeez." Truman said. " All I want to know is why you think Verrand's island cannot work."

"I understand." Sophin said. " I'll get there. Chaos theory says two things. First that complex systems have an underlying order. Second, it also says that simple systems can produce complex behavior. In theory, in a pure Newtonian system, pool table for example. If you hit one ball, it will carom off the corners of the table is a predictable way, right? In theory, you should be able to calculate the behavior of the ball all the way into the future, say three hours?"

"Okay…" Truman nodded.

" But in fact, you can't predict the behavior of the ball for more than a few seconds into the future. Because almost immediately tiny imperfections in the ball, tiny indentations in the wood- start to make a difference, and it doesn't take long before they overpower your careful calculations. So it turns out that this simple system of a pool table has unpredictable behavior."

" Okay."

"And Verrand's project, " Sophin said. " A apparently simple system of animals within a zoo environment will, like the pool table, start to show unpredictable behavior."

" You know this because of…"

" Theory." Sophin said.

" But shouldn't you see what he has done," Truman said, " To decide for yourself?"

" That's quite unnecessary," Sophin said. " Theory tells me that this island will behave in an unpredictable fashion."

" And you are confident of your theory…" Truman said.

" Absolutely," Sophin said. " There's a problem with this island, it's an accident waiting to happen.

To be contuined...
from Billy Macdraw, age 18, ....., ....., .....; October 23, 2000

Old Blood

3. Old Blood

Drummond led the group up a stairway to the second floor, and stopped the group outside a door with a sign that ominously read:

CLOSED AREA
AUTHORIZED PERSONNEL ONLY
BEYOND THIS POINT

Gurmit felt a trill when he saw the sign, at only twelve years of age, he was going to be one of the first people from the outside ever to see how the dinosaurs were made. Well, such perks came with having a grandpa who was the chairman and founder of a genetics company.

Drummond slid his security card through a slot in the door and a small red led went off, replaced by a green led. "Here we go." Drummond said as he pushed the door open. The corridor that lay beyond was much like the others. Drummond continued to lead them to another door down the corridor, it was a big door, a sign on it read:

CAUTION
TERATOGENIC SUBSTANCES
PREGNANT WOMEN AVOID EXPOSURE
TO THIS AREA

DANGER
RADIOACTIVE ISOTOPES IN USE
CARCINOGENIC POTENTIAL

" I assume we are safe?" Steve Red, the legal advisor asked. Looking at the signs.

"Don't worry," Drummond said. " These signs are here for legal reasons, we're perfectly safe." He used his card on the door again, this time the doors slid apart, revealing a big laboratory of some sort.

Truman saw fossils lying in cardboard boxes behind a sealed room. The boxes were marked and labeled. The fossils were bathed in a blue light, probably to protect them, Truman deduced.

The moment Wato saw the room, he knew he was going to make a fortune out of this place, his zoo was going to be the first zoo ever to have a dinosaur. He hoped that this place was safe. Mentally, he started selecting the first dinosaur we was going to buy for his zoo.

Gurmit looked around excitedly; he saw another room, which had what looked like eggs in an incubator. He looked around, trying to see some more.

Drummond introduced Gregory Tremblay, a slender man in his thirties. "Dr Tremblay here is our chief geneticist, he will explain how we manufacture the dinosaurs."

" I'll try, at least. " Tremblay said, " You can call me Greg. " He smiled and looked at them. " You must be wondering where we get our paleo-DNA from."

" As a matter of fact, " Truman said. " It has crossed my mind."

" Let, me guess. "Timon Horner cut in. " You used the Loy antibody extraction technique."

Truman had developed a dislike for Horner. Horner has been well known in the paleo-world for being good at raising funds, and not much else. As one somebody said, there were two types of paleontologists. The experts and the experts and raising funds. Horner was not too much of a paleontologist, though he liked to stir up the paleo-world by challenging long-held ideas. Truman didn't have a problem with challenging ideas, but Horner loved to challenge ideas for the sake of challenging them, not because he had really observed anything to the contrary. Truman remembered that Horner had pioneered most of the Tyrannosaur dedicated-scavenger theory, and the Tyrannosaur amphibian visual cortex theory with another fundraiser called Roxton. Their papers were misleading to the public, and, as Truman once put it, rubbish.

" True, we can extract DNA using Dr. Loy's method. Greg said. " We can extract up to twenty percent of the DNA by grinding up the bones and using his procedure. His technique is so refined, we can work with a mere fifty nanograms of material. The problem is, a twenty percent yield is insufficient for us to work with."

" So, how do you get the entire strand?" Truman asked.

" Well, the Loy antibody procedure extracts the surviving protein, the original DNA," Greg smiled. " The problem is, most of the soluble proteins are leached out during fossilization, replacing the original protein with inorganic material." Greg paused. " To get the entire strand, we find the fossil within the fossil."

Truman looked to Wilson, and then to Sophin.

" It's really quite clever. " Sophin said.

Truman looked back at Greg. " I still do not understand."

" As we know, we only receive fragments of DNA because some of it has been destroyed." Greg said. " The good thing is, the proteins that are lost do leave a "fossil" of themselves. During our research, we noticed that the destroyed proteins had subtle differences in solubility, making the inorganic material that replaced them different. Using that, we figure out what protein was destroyed."

" But the DNA strand is big, it would take you very long to get the entire strand by finding out what was destroyed." Truman asked. " How did you do it in such a short time?"

" Correct. DNA is a big thing." Greg said politely. " But dinosaur and modern avian DNA is very similar, thus all we need is to deal with the parts that are different. " We figure the parts that are different, and run it through a supercomputer. The computer detects the lost proteins by detecting the differences in the inorganic material, replaces them with the corresponding protein and repairs the strand through the use of restriction enzymes." Greg smiled again. " Actually, save for the lack of amber, this technique is quite Jurassic Park. In short, we are not using the original strand, but building up the strand by using fragments of modern avian DNA, old paleo-DNA, and replacing the lost proteins.

" I see." Wilson said. " But how can you be sure that you have really built up the original strand?"

Greg nodded. " I have thought about this. We can't be sure. All we are doing here is to retouch an old photograph, to restore it. The fact is; we can never get the original back. Tyrannosaurus Rex is lost forever, the T.Rex we have here is technically the best and most realistic restoration we can currently do." He looked at Truman. " That's why one day I hope paleontologists such as yourself can compare our work here to the fossil record to verify our work." He smiled politely. He led them to a screen with lines of data flowing so fast, it was impossible to read.

"This is where we repair our DNA," He said. " Here, I will show you how it works." He tapped a key and the screen froze. " Here is our flawed string," He pointed to a line of data.

Tric-45A ^ AVIA ^ 781 ATGCTCCTGAATCCTTGGATATCCTTTTCCATTCGGATTATGGCCCTTTTCTCCCAAAG 841 GTTAAAACCCTTTAAAGG****CAATTAAACCCCCAAAGG##D#CCCAAAGGGTTTAAA

" There, line 781 is alright, but 841 needs something to be done about it." Greg pointed to the line. " The asterisks you see represent a fragment of DNA that is completely missing, without any non organic material to replace it. The other error down the line represents a protein that has been lost through fossilization, but it has been replaced by inorganic material. This is how we repair the damage."

1416DnxTi ##D#

SSpd4

GTAC 841 GTTAAAACCCTTTAAA-GG****C-AATTAAACCCCCAAA-GG##D#CC-CAAAGGGTTTAAA

" The computer will select specific restriction enzymes to cut to both sides of the damage portion." Greg explained. " After which we will replace- or rather, the computer will select a piece of DNA that overlaps the injury to repair it. The non-organic material is also cut away and the corresponding protein filled in. This is the repaired strand:"

841 GTTAAAACCCTTTAAA-GGGTCC-AATTAAACCCCCAAA-GGGTACCC-CAAAGGGTTTAAA

" What you have just seen would have taken four months to do in an ordinary lab, " Greg said. " But the computer does it here in a matter of seconds. This requires a lot of computing power of course that's why we use a Multi-XMP system- in English, we use multiple Cray supercomputers to do our work."

" I have another question, one the computer has encoded the DNA, how does it know what animal it encodes?" Truman asked.

" Well, we usually assume the DNA that comes from a Tyrannosaur fossil is the DNA of a Tyrannosaur." Greg said. " But we usually just grow it and find out." Truman would have slapped himself. It was a low-tech answer to a high-tech solution.

Gurmit was starting to get bored, he liked technical stuff, but most of what was going on was way beyond him. He wanted to see the dinosaurs.

Greg led the group past a room with technicians working at microscopes. Behind was a blue section totally bathed in UV light. " What are they doing?" Gurmit asked.

Greg smiled at the boy. " Our work also involves the interruption of cellular mitosis at precise moments. To do so, we have to use some of the most virulent poisons in the world like helotoxins, colchicinoids, beta-alkaloids. All this is quite complicated and quite far beyond you. Maybe I will explain it to you if you work for us one day." He continued to lead the group around to another room. " This is the fertilization room, where we put the embryos into their eggs." He unlocked the door and led them in.

" That brings me to my next question." Truman asked. " How did you find the median to raise the clone? From what I know, we need the eggs of a dinosaur of the same species to successfully grow the clone."

" Not totally true." Greg answered. " Surrogate birth has been done all the time in mammals, they have made cows give birth to sheep. Theoretically speaking, we could also raise the dinosaurs through surrogate birth also, but the need of an egg complicates the process making it difficult, but not impossible."

" The main problem is, " Greg continued. " Modern animals are quite different from dinosaurs; therefore, no viable host species exist for us to successfully raise the animals through surrogate birth."

" So how exactly did you solve the problem?" Horner asked.

" We made a host species." Greg answered matter-of-fact. " More exactly, genetically altered unfertilized crocodile ova tailor made to accept dinosaur embryos. The eggs themselves are not real, they are made of a special polymer developed by the aerospace industry which has the properties of an avian eggshell. They are not the best, but they make a good substitute. " Greg moved them to another room.

This room was different from the others, a fine, damp mist coated the room. On many pale, cream colored eggs sat on specially designed tables all over the room.

" Please do not touch the eggs, they are permeable to skin oils." Greg explained. " This is where we incubate the eggs. The oxygen level in this room has been upped by 30 Percent to simulate the general conditions in the Mesozoic era. " Tell me if you feel faint."

" Well, we have nothing hatching here for a while." Greg said. "To maximize their chances of survival, we usually move the hatching to a nursery, where it is supplied with Mesozoic atmosphere and general conditions to reduce any stress on them. But even so, we still lose up to seventy percent of the newborns. The survival rate in the non-clones are much higher though, at about fifty percent."

" The non-clones?" Wilson asked, puzzled.

" Yes, each dinosaur costs us about three million to produce by cloning. Therefore, the cost of growing a sizeable stock of dinosaurs is astronomically expensive. Therefore, we encourage our adult dinosaurs to breed."

" Your dinosaurs breed?" Sophin asked, amazed.

" Yes, we usually encourage the parents to raise their young." Greg said. " Newborns raised by the dinosaurs usually have a higher survival rate." He held an egg up with a rubber glove. " However, as some animals like the sauropods have a very low libido, taking up to twelve years to be fully mature before they can breed. These are the animals we have to clone." He moved out of the room. " Most of the time, we just clone a pair and let them breed."

He led the group to another room. " This is the nursery." He looked at the woman sitting at her desk beside the door. " What do we have today Jane?" He asked.

" Not much," She said. " Just a baby sauropod."

" Contrary to popular belief, " Greg said. " Most sauropods- at least the species we clone do not take care of their young. Instead, they produce about a hundred eggs at a time, to ensure at least some survive." He unlocked the door and led them in. The air was warm and humid. " General Mesozoic conditions." He explained.

The baby sauropod was about a meter long, with a green and brown draped body. It had a short neck and a short tail. In fact, it didn't even look like a sauropod at all.

" What species is this?" Truman asked.

" Well…" Greg trailed of, reading a chart. " Diplodocus."

" But it doesn't look like a Diplodocus at all." Gurmit said. The animal was tame and allowed itself to be handled. Gurmit picked it up slowly, it's surprising weight making him cautious.

" The babies will start to resemble the adults more when they get older. " Horner said. " What do you feed it?"

" Ferns. But it won't eat for a while yet. It's still digesting the remanding yolk from the egg." Greg looked at Gurmit. " The babies are usually quite timid, but with frequent handling, they become accustomed to us, come, we have to go now." He led the group reluctantly out of the room.

" How long do your animals take to mature?" Wilson asked, glancing at the Diplodocus through the window of the room as they exited it.

" Well, we engineer the animals to mature faster, so they do so in about five years, ten for the bigger ones." Greg explained. " The domestic animals mature even faster though."

" Domestic animals?" Sophin asked.

" Well, the animals we'd most like to see are the dinosaurs in their true, as-nature-intended-it form." Greg explained. " We do make them, and we intend to sell them to zoos and such. But we also make dinosaurs for other purposes, like pigmy, docile raptors for pets and fast growing, fast breeding Edmontosaurs for food and such."

Sophin shook his head. " I assume maintaining this facility requires more than simply cloning dinosaurs."

Greg looked at Sophin for a moment before saying. " That is true, in fact, this tour of our laboratories is complete. Drummond will now take you to our control room. Please follow him out." He motioned to Drummond.

Drummond nodded. " This way please." He said quietly. He slowly led the group out of the lab. Greg followed.

To be contuined...
from Billy Macdraw, age 18, ....., ....., .....; October 22, 2000

Intreasting story....
from ?, age ?, ?, ?, ?; October 22, 2000

Okay guys, this is your lucky day. I have completed another installment. Please follow the chapter numbers to read the story in order.
from Billy Macdraw, age 18, ?, ?, ?; October 22, 2000

Old Blood

2. Briefing

It took them a good hour to finish the meal. Drummond moved into the room after the last plate was taken away. Verrand nodded at him and Drummond hit some kind of a remote. The lights in the room dimmed and a video projector hummed to life. It projected an image of an island on the wall, and Drummond moved in.

" I am Drummond Francis, manager of this Horizon Genetics facility." He pointed at the image. " What you see here is one of the Greater Sunda Islands in the Java sea. The locals call this island in question Asura Mati. It has been leased over to Horizon Genetics by the Indonesian government. It's about a hundred kilometers off the mainland of Borneo.

Truman nodded grimly, one of the reasons why so many bioengineering companies liked to set up shop in Asian or third world countries was to escape legalization. The governments of such countries were only all too eager too welcome big investors like such companies to boost the economy, caring much less about what the companies was actually doing. Free of any legalization that they may find back home, such companies could do whatever they liked, as recklessly as they wanted.

" This island provides a good climate to rear our animals. It is close to the equator, and the climate is roughly similar to that of which the dinosaurs lived in, except a little cooler and with less oxygen in the atmosphere, but our animals live quite well here." Drummond said.

" Actually, what we are doing here is not a dinosaur theme park," Drummond explained. " But it's more of a factory, manufacturing products from prehistoric animals for the world, anything from zoo animals to Edmontosaurus steaks- I hope you enjoyed that one. " Nervous laughter broke out through the group.

" Mr. Verrand has invited you people here to see this facility and endorse it for him, if you decide to do so of course." Drummond said. " Of course, " He smiled. " I know this changes everything for you in your area of expertise. But Mr. Verrand has some job offers for you, in case we accidentally drive you out of a job." There was more nervous laughter.

" We're going to take you on a tour of this place, " Drummond said. " But for now, you are going to our labs to see how the dinosaurs are created." Mummers broke out through the group. " Now, it you would please follow me."

Drummond led the group through a series of corridors. Truman looked around. The walls were painted starch white, nothing decorative was added, it was functionality, all done in the name of functionality.

" I'll sure like to find out how they managed to do it." Truman whispered to Wilson as they moved down the corridors.

" Simple," Wilson said, somewhat sarcastically. " By not assuming they couldn't."

" But the hurdles in such technologies are paramount!" Truman said. " First, you will have to find a complete DNA strand to work with. From what I know, fossilization destroys most of the DNA. Secondly, you'll need a medium to clone the animal from, like a dinosaur egg. There are no eggs fit for raising a dinosaur clone. A dinosaur egg is needed, of the same species and DNA to enable the clone to develop, but we don't have such. "

" Obviously, they found some way of doing it." Wilson shrugged as they moved on. " And we will see it for ourselves quite soon."
from Billy Macdraw, age 18, ........., ................, .....................; October 22, 2000

My favourite dinosaur is the Tyrannosarusrex because it is strong and has shrap teeth.
from Domenic D, age 10, Adelaide, S.A, Australia; October 22, 2000

My favourite dinosaure is the Tyrannosaurusrex because it is the King and it has strong everything.
from Laura D, age 10, Adelaide, S.A, Australia; October 22, 2000

Well, here comes another Old Blood installment.
from Billy Macdraw, age 18, ?, ?, ?; October 22, 2000

T.Rex is cool. The Velociraptors are good to eat.
from Savin L., age 12, Perth, ?, Australia; October 22, 2000

Velocerapter becauce he is a fast runner and a fierce dinosaur.
from Darren, age 9, Melbourne, Victoria, Australia; October 22, 2000

T-rex because he is the meanest and the fiercest dinosaur.
from Rhys .T. &Jarad.C., age 10&9, melbourne, victoria, Australia; October 22, 2000

I hate to make you cry Tyranno, but T.rex could run at 35 MILES per hour. HA HA HA HA (Trival technically). VOTE REX!
from Mr BORON, age ?, ?, ?, ?; October 22, 2000

tricertops because they are planteaters
from joey h., age 10, emporia, va., greensville; October 22, 2000

hetrodontosaurs because they r kewl
from jack R, age 7, west paterson, hongkong, china; October 22, 2000

Tyrannosaurus Rex because he was is Jurassic Park,and because he could run 30 miles an hour
from Tyranno, age 7, Mira Mesa, Calofornia, United States; October 22, 2000

He is farrrrrrrrrrrrrrrrrrrrrrrrrrrrrr better than the raptors. From what Levine said, he replaced the raptors as dominant predator.
from T.Rex, age 7, ?, ?, ?; October 22, 2000

Rhamphorhynchus is my favorite because I colored his printout. Shea age 7
from ?, age ?, ?, ?, ?; October 22, 2000

Old Blood

1. Almost Jurassic Park

" That Gallimimus…" Truman asked quietly as he watched the startled dinosaur run away, back to a group of about ten about fifty yards away. " It's real, isn't it?"

" Oh yes, very real." Drummond said. " Not terribly intelligent, but quite aggressive when threatened. They are quite social. That individual we almost ran down is an outcast, thrown out of- hey, are you all right?" He noticed Truman had a strange grin on his face.

" Yes, I haven't been better. How many dinosaurs do you have over here?" Truman asked.

" About a few hundred, I'm not too sure about that part, why don't we move on? You will have all of your questions answered later." Drummond started the jeep down the road.

" I guess this changes your field quite a bit?" Wilson asked.

" A bit? This changes everything, People have been talking of doing this, bring them back to life. But we thought it was impossible." Truman grinned.

Wilson laughed. " The history of our species, is that we thought it was impossible." She turned to Drummond. " Is this some Jurassic Park you're making here?"

"No, no, not quite." Drummond betrayed a slight air of annoyance. "Look, I'd like to answer all of your questions, but I am sure somebody better will do so later. Right now, I have to watch where I am going. These free-running animals are not terribly smart."

The rest of the journey proceeded without incident. The jeep drove up to a group of large buildings, huge concrete hexagonal structures surrounded by another perimeter fence. The buildings reminded Wilson of bunkers, only these were many times larger. Drummond drove through the front gate and parked the jeep near the entrance of the largest building. He got out and opened the doors for them. "This way please." He motioned with his hand.

They got off the jeep and walked briskly to the building. Drummond escorted them past the security post and into the building. As they walked in, they passed an open door with the word "Animal control" stenciled on it. Truman gave the room a glance and saw racks of small arms weapons with a rough-looking man inside fiddling with what looked like a gray plastic tube. The dark skinned man put the tube away and walked out the room, locking the door before catching up with them. "Drummond, Verrand will be meeting these guests in the restaurant."

"What? He started already?" Drummond seemed surprised.

"What does this mean?" Truman asked.

" You're late." He said dully.

The restaurant was a little more than another room in the building. Drummond motioned them in and left. Truman noticed the old man sitting at one end of the table. He remembered the way he ate his food, the way he swung his leg that imparted a childlike quality to him. Truman remembered the last time he met this figure was in a convention about five years ago; Verrand. Five other people sat around the table, eating.

" You have finally arrived." Verrand said. " Have a seat. I assume you have acquainted yourself with the local Gallimimuses? " Verrand wasted no time in introducing the people at the table. " This is Mr. Wato, the head of the Japanese Zoological Gardens, this is my grandson, Gurmit, and this is Mr. Steve Red, my legal advisor, and finally, this is Timon Horner, another paleontologist like you." Truman noticed he didn't introduce one person, who ignored all this and went on eating. "Have a seat, we've been talking about you."

Truman nodded and smiled. A few people returned the smile politely. Just after he sat down, a waiter arrived, placing some kind of steak in front of him. He cut out a piece and sampled it, it tasted like chicken. That wasn't right, you couldn't make such a big steak out of chicken.

Wilson was equally puzzled. " What is this?" She asked, sampling more of her food, puzzled by the exotic taste.

" We prefer to call it Edmontosaurus, " The waiter said with a smile. " Try it."

" Th-this is dino meat?" Wilson looked at the cube of meat speared on her fork "You serve your dinosaurs here?"

" Why of course we do. Do not be put off by the idea, it tastes exactly like a giant chicken." The waiter couldn't stop smiling.

" What exactly are you doing here? " Truman asked, confused. " Jurassic Park?"

"It's a good idea, but not entirely practical." Verrand said, giving one of those irritatingly sweet smiles he was so good at doing. " What you are seeing here is not a dinosaur theme park, but a factory." He had answered the same question from all the other visitors for the whole day now, and was starting to tire of it. " A theme park of Crichton's scale would be far too complex and way beyond the ability of my company. I am keeping things simple here."

" Simple? I hardly consider manufacturing dinosaurs a simple task. " A man at the table suddenly said. " I believe this so-called factory is inherently unstable." He was a thin, balding man of about thirty.

" Alex Sophin." Verrand introduced the man. " A man I hired to work up a computer model of this project." He paused. " Anyway, what I am trying to do here is simply to manufacture a line of dinosaur products, anything from a children's pets to a full sized Tyrannosaurus Rex. The reason I invited you here Truman, is to verify the accuracy of my animals to potential buyers. " Verrand motioned with his hand to a group of people sitting on the left side of the table. " Don't get me wrong, this is no Jurassic Park. "

To be continued…
from Billy Macdraw, age 18, Invalid, Invalid, Invalid; October 22, 2000

My goodness! How far will those Raptor fans go? They have to make a robot the size of Gigantosaurus and give him Ginsu knives? My my! Are the raptors so lously they need such a big mechnical upgrade? Billy I admire you. At least you use real dinos to fight!
from Crystal, age ?, ?, ?, ?; October 22, 2000

T.Rex, I believe the Raptors were inferior. Stravags!
from Lincon O., age 12, Ironhold, ?, Falcon prime; October 22, 2000

T.Rex, he kinda reminds me of Coolcat!
from Tommy Lee P., age 8, ?, ?, ?; October 22, 2000

Shortz Dino Warz

Tinker: Hey, hey tinhead!
Megaraptor2001 type x: Wha..Why is T.Rex still alive? Tinker: Because the robot Rex you destroyed ws the cheesy robot rex they used to film Carnosaurs! That robot couldn't even fight! Shame on you! Fighting something so harmless!
Megaraptor2001 type x: Does not compute...Terminate subject.
Tinker: Not on my watch! (Takes out RPG-7, launches! Woosh!)
Megaraptor2001 type x: (Boom!) Superfical damage... (There is a huge hone in his armour, but he is otherwise untouched, approaches Tinker.)
Tinker: Uh Oh... (Takes out M-16 rifle with a M-203 Grenade launcher attachment-RATATATTATATATATTATA.)
Megaraptor2001 type x: Smalls arms fire is ineffective...(Bullets glance of him as he approaches Tinker.)

Tinker: UH OH... (Launches granade from M-203 launcher. TONK!) Megaraptor2001 type x: No damage sustained from grenade. (Grenade flies into the robot through the hole caused by the RPG, bounces around inside Megaraptor2001 type x)
Tinker: Think again, tin can, see ya candy boy! (Runs and jumps for cover.)
Megaraptor2001 type x: Termate subject-MASSIVE SYSTEMS FAILURE- (KABOOROOM!!! THE GRENADE EXPLODES INSIDE HIM, RIPPING HIM TO PIECES OF SCRAP METAL.)
Tinker: Yaaayy! I win! If you are wondering where Sue is, well, she is in the hospital recovering from the wounds sustained while rescuing me.

The end.

Moral of the story: Don't mess with Tyrannosaururs when you are full of bull, he will kick your butt!
from Billy Macdraw, age 18, ........, .............., .................; October 22, 2000

yada yada yada, rant whatever you want Coolcat/copycat. Oh yes, and by the way, here....is....one....more...vote....for....t-rex....ha ha ha ha ha. Okay, serious. One more story installment coming up.
from Billy Macdraw, age 18, ?, ?, ?; October 22, 2000

You know why we don't mind offending others by liking T.Rex? Because he is wayyy too popular and good to bother about tiny fry like you. You are ayam katick* you know? ayam Katick* *ayam katick means small chicken
from Honkie Tong, age ?, ?, ?, ?; October 22, 2000

Coolcat! You should cool down, not too cool now are you? I vote T.Rex HA HA!
from Martyl Pryde, age 12, ?, Texas, US; October 22, 2000

you know i'm getting really sick and tired of people offending me today! get a hobby!, all though yours is probibly offening others! why can't you juz respect people for their choice of dinosaurs! is it all that hard or do you enjoy it! and people don't act like i'm stupid cuz i'm not! SUE ME BILL! you know i'm not going to fall down and worship trex!
from coolcat, age 24, ?, ?, ?; October 22, 2000

a t-rex..because he is soooo big
from adrian M, age 4, las vegas, nevada, usa; October 22, 2000

Big and ugly and mean.........T-Rex
from Sean B., age 6, Fort Worth, Texas, U.S.A.; October 22, 2000

Old Blood

Prologue: Arrival

The pilot didn't waste anytime bringing the helicopter down to earth. He killed the engine the moment the wheels hit the ground. In the helicopter, Truman paused dramatically before removing his safety harness. A man escorted him out of the helicopter quietly.

"I am afraid we had to make a hasty landing," The man explained. "But the noise disturbs the animals."

Truman nodded. He was thirty-five and a familiar figure in the paleontology, having pioneered most of the "Warm blooded" revolution with Robert T. Bakker. He frowned as he surveyed the scene before him, his detective skills coming into play. He was obviously on some island in the tropics. The air was humid and a thin haze hung in the air near the native rainforest. The surf played on a gently sloping beach behind him. What he could not figure, was for what reason he was so hastily summoned to this place by his sponsor.

"Do you know what they want us here for?" It was the second time the helicopter's other passenger had spoken to him. Truman shook his head. The other person had introduced herself earlier as Jayne Wilson, an animal biologist-studying lions in the African savannas.

"Your questions will be answered later," The man said. " Please follow me."

He guided them to a red and white jeep, and opened the door for them. They entered. " I am Francis Drummond, I work for Mr. Verran." He got into the driver's seat. " Please bear with me, it will not be a long journey." He started the jeep and drove them along a small road leading into the rainforest.

"So, they brought you here hastily?" Wilson asked, breaking the uneasy silence in the jeep. Her short, compact frame slouched in the jeep's leather seat.

"Yes, I assume they did the same to you too." Truman said. He had no idea as to why he was called all the way across the world in such a hurry.

"So, he sponsors you too?" Wilson asked again. Looking out of the windows as the jeep drove through the rainforest.

Truman nodded. Unlike most other fields of science like physics or chemistry, which were government funded, Paleontology remained strictly a privately funded venture. Every paleontologist needed a sponsor in order to work, unless he was really wealthy. Truman had chanced upon Mr. Verran in a convention, and struck up a deal. The only thing Verran ever asked for in return for his funding were some damaged fossils that could not be displayed. Every time, Verran's company would take the fossils, hold them for a month or two before returning them back for Truman to study. Sometimes the fossils never returned at all. This greatly puzzled Truman, but for the sake of having funds to dig, he kept silent.

"I thought as well," Wilson said, running her fingers through her short hair. " He paid for my studies in university and my trip to the savanna, saying he expects my services someday." Wilson didn't look to far beyond twenty, but Truman could tell she was tough. Her well tanned skin and traumatized, rough clothes gave him insights to her character. He didn't figure her for the soft type.

The jeep stopped at a fifty-foot fence. Drummond waved to a lazing workman in a concrete building near the fence. The man got up and promptly threw a switch on the wall of the hut A slight electric hum was audible in the air as Truman watched this happen. A gate in the fence started to open quietly and Drummond drove through.

" May I ask where we are." Wilson asked, apparently puzzled by the fence. " What is this place?" She kept looking at the fence until the jeep navigated a bend and stole it from sight.

" You have just seen our perimeter fence," Drummond explained. "It keeps the animals' in. " He continued to drive. " Do not worry, you will have your answers soon enough."

Wilson frowned; she wanted to know the answer now. She tried to look for a road sign that might give her a clue as to where she was, but found none. This island probably housed was obviously some kind of private facility owned by Verran, but its real function still eluded her. She used her hand to shield her eyes from the sunlight as the jeep suddenly drove out of the rainforest and into a clearing. Just then, the jeep braked. Drummond swore and Truman started to say something but trailed off. Wilson raised her head to see what was the cause for the commotion. The jeep had braked to avoid hitting something.

" Stupid animals." Drummond said. " Verran will have my head if I knock one down."

"Is that real?" Truman asked quietly, standing and looking out of the open top of the jeep.

What was going on? What was all the commotion about? Wilson stood up, her five-foot nine frame offering enough height to see what the jeep had avoided knocking down. It was some kind of animal, a flightless bird of some sort. It was big, about seventeen feet long. Wilson noticed that this animal was not a bird. It has no feathers and had too long a tail. A name that came all the way from her childhood shocked her as it flashed in her mind:

Gallimimus.

It was a dinosaur, a real dinosaur.

To be continued…
from Billy Macdraw, age 18, Invalid, invalid, invalid; October 22, 2000

Coolcat, can you come up with a more original piece of work? Don't copy dino warz! Anyway, here's one vote for T.rex and a message: Old Blood part 2 is coming up
from Billy Macdraw, age 18, ?, ?, ?; October 22, 2000

My favorite dinosaur is tyrannosaurus rex. He is cool! All you other people better agree with me.
from firebird, age ?, ?, ?, ?; October 22, 2000

My favorite dinosaur is Tryannosaurus Rex because I think T-rex is really smart and strong.
from Felix P., age 9, Worcester, Massachusetts, U.S.A; October 22, 2000

my favorite dinosaur is the t rex it is big and strong it was one of the biggest meat eaters there ever was but when the giganotoesaurus came the t rex was not so big any more the giganotoesaurus was probebley about the same size but if there was a fight between the t rex and the giganotoesaurus the giganotoesaurus would lose because the t rex had a smater brain but it was also tougher stronger and meaner
from christopher j, age 10, manchester england, england, Britain; October 22, 2000

my favorite dino is ankylosaurus. because it's tail is as hard as a golf club.
from TRE' S., age 6, oklahoma city, ok, us; October 21, 2000

All the raptors together have 856 votes.Keep voting! ROOOOAAARR! We needmore votes to battle!
from Megaraptor, age ?, ?, ?, ?; October 21, 2000

Giganotosaurus is my favorite dinosaur because he was the biggest meat eater ever discovered!!!
from jeff h, age 6, Quakertown, Pennsylvania, USA; October 21, 2000

my reserch concludes that megaraptr2001
type x will be king!!!!! i battled megaraptr aganist a robot trex! here's what happened:
coolcat: let the battle begin!
megaraptr: i will win, you can't beat me. RRRROOOOOOOAAAAARRRRRR!!!!! WHAM!(hits roborex with his tail. roborex goes flying and hits a wall!)
roborex: AAAAAAAHHHHHHHHH! BOOM!!!!
roborex: i will beat you!
megaraptr: why don't you sit down! (pushes roborex down.)
robotrex: ROOOAAAAR! (rams , thowing him across the room!)
Megaraptor: OUCH! that hurt! pay back time! CHOMP!
Roborex: my arm!
Megaraptr: RAM!!!!! (roborex falls apart!)
Megaraptr: i win!
from coolcat, age ?, ?, ?, ?; October 21, 2000

T-Rex because its almost bigger than a long neck. It can beat a long neck also.
from Zach L, age 5, Lake St. Louis, Mo, USA; October 21, 2000

I picked the T Rex because he is a meat eater and he eats any kind of dinosaur and he has sharp teeth and he is scary and that is why I picked him.
from Trevor W, age 10, London, ?, England; October 21, 2000

(mechanical ROOOAAAAAARRRRR!!!!!!) Must destroy trex. ROOOOAAAARRRR!! Face me you wimpy trex! I will be king! HA! HA! HA! I have 1 weakness which I won't tell to anyone! HA! Raptors will be king!!!! ROOOOAAAAR!!!!!!!!!!!!!!!!!!
from Megaraptor2001 type x, age ?, ?, ?, ?; October 21, 2000

this is my new creation, the megaraptr2001 type x.he is programed to destroy all trexes! those trexes don't stand a chance! he is the size of a gigantasaurus and has claws the size of knives!
from coolcat, age ?, ?, ?, ?; October 21, 2000

Tyrannosaurus IMPERATOR! you can count it as a vote for T.Rex though.
from Jamie, age 6, ?, ?, ?; October 21, 2000

trex, i donno why
from ?, age ?, ?, ?, ?; October 21, 2000

Old Blood

Introduction: Impossibility

Have you ever thought that your neighbor owned a 2-meter long Velociraptor for a pet dog, taught him tricks, then rolls over their house? Everybody's dying to see an authentic live dinosaur. Remember Jurassic Park? They took a dinosaur DNA sample from the gut of an amber-sealed Jurassic mosquito, filled in the gaps in the dinosaur DNA with frog DNA, and placed it in a viable host egg, then they've got big lizards for their tourist attraction. The procedures done in the film is almost the actual thing done in cloning life forms. However, back in reality, there are missing a part, which are vital for dinosaur cloning and makes it questionable or impossible to do such. Here are some of the things that make mass-production of dinosaurs a big question mark.

AMBER ENCRUSTED MOSQUITO - amber, a hard yellowish-brown fossilized tree resin, is a good preservative medium. There are lots of amber-sealed insects retrieved and scientists had already drawn DNA from these insects, but only insect DNA, not the DNA of it's last victim. The fossils were so tiny, and so as the information gathered. Even if the stone-age mosquito did have a big bite on a dinosaur, the process of digestion would easily damage the dinosaur DNA. Lastly, the fossilized insects are no more than 40 million years old, 20 million years after the disappearance of dinosaurs, and 95 million years after the end of the Jurassic period.

DNA or Deoxyribonucleic Acid - the very precious, but fragile cellular substance that is responsible for hereditary instructions and input in every complex organism. Dinosaur DNA will not be clear and intact for the 65 million years that have passed since the dinosaur has gone to extinction. This is because of the fact that while humans and animals are alive, the DNA gets damaged 10 times every second. However, this is not much of a problem since there are special biological processes that repair damaged DNA. When life ceases, the reparation processes stop, and the DNA breaks down. If a mosquito feasted on a dinosaur and immediately gets trapped in tree resin and is preserved, the deterioration will slow down, but it will not stop. After 65 million years, the dinosaur DNA will be messed up and would be very difficult to decode.

DINOSAUR BLUEPRINTS - All DNA structures, be it human or animal or dinosaur, is made up of the same components, but they differ in sequencing. To find a piece of bird DNA, you would have to compare the sequences to an authentic bird DNA. In relation to the dinosaurs, there are no more existing dinosaurs, so whose DNA can be used for the identification of dinosaur DNA? The identification of dinosaur DNA would be quite an impossible task. CLONING MEDIUM - there are no eggs fit for raising a dinosaur clone. A dinosaur egg is needed, of the same species and DNA to enable the clone to develop, but we don't have such.

The cloning of dinosaurs is within the point of possibilities and impossibilities. Yes, we have the technology of cloning animals, which was recently concluded by Dolly the Sheep, the first successful animal clone, but what we don't have are the biological raw materials that will take us to the rebirth of dinosaurs. As of now, the scene of having a Velociraptor as a pet is still beyond the mist.

Truman Jr. 1998

To be continued…
from Billy Macdraw, age 18, Invalid, Invalid, Invalid; October 21, 2000

T.Rex, it's a powerful dinosaur, it's more daedly than the Raptor.
from Horman. J, age 12, ?, ?, ?; October 21, 2000

Return to the top of the page.

Earlier Dinosaur Favorites

Enchanted Learning^®
Over 35,000 Web Pages
Sample Pages for Prospective Subscribers, or click below

Click to read our Privacy Policy

E-mail